G protein alpha S (GNAS) (NM_000516) Human 3' UTR Clone

CAT#: SC205188

3' UTR clone of GNAS complex locus (GNAS) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name G protein alpha S (GNAS) (NM_000516) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHO; C20orf45; GNAS1; GPSA; GSA; GSP; NESP; PITA3; POH; SCG6; SgVI
ACCN NM_000516
Insert Size 393 bp
Sequence Data
>SC205188 3’UTR clone of NM_000516
The sequence shown below is from the reference sequence of NM_000516. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGCACCTTCGTCAGTACGAGCTGCTCTAAGAAGGGAACCCCCAAATTTAATTAAAGCCTTAAGCACAA
TTAATTAAAAGTGAAACGTAATTGTACAAGCAGTTAATCACCCACCATAGGGCATGATTAACAAAGCAA
CCTTTCCCTTCCCCCGAGTGATTTTGCGAAACCCCCTTTTCCCTTCAGCTTGCTTAGATGTTCCAAATT
TAGAAAGCTTAAGGCGGCCTACAGAAAAAGGAAAAAAGGCCACAAAAGTTCCCTCTCACTTTCAGTAAA
AATAAATAAAACAGCAGCAGCAAACAAATAAAATGAAATAAAAGAAACAAATGAAATAAATATTGTGTT
GTGCAGCATTAAAAAAAATCAAAATAAAAATTAAATGTGAGCAAAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000516.7
Synonyms AHO; C20orf45; GNAS1; GPSA; GSA; GSP; NESP; PITA3; POH; SCG6; SgVI
Summary This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012]
Locus ID 2778
MW 15.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...