Hmgn3 (BC005693) Mouse Untagged Clone
CAT#: MC207028
Hmgn3 (untagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | TRIP7, HMGN3a, HMGN3b |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005693
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGAAGAGAAAGTCTCCCGAGAACACAGAGGGCAAAGATGGAACCAAGCTAACTAAGCAGGAGCCCA CAAGACGGTCGGCCAGGTTGTCCGCGAAACCTGTTCCACCAAAACCGGAGTCTAAACCAAGAAAAACATC AGCTAAGAAAGAACCTGGAACAAAGATTAGCAGAGGTGCTAAGGGGAAGAAGGAAGAAAAGCAGGAAGCT GGAGAGGAAGGTACTGCACCATCTGCAAATGGTGACACTAAAGTTGAAGAGGTACTTTCCACAAACACCT CCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC005693 |
Insert Size | 288 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC005693, AAH05693 |
RefSeq Size | 1419 bp |
RefSeq ORF | 287 bp |
Locus ID | 94353 |
Gene Summary | Binds to nucleosomes, regulating chromatin structure and consequently, chromatin-dependent processes such as transcription, DNA replication and DNA repair. Affects both insulin and glucagon levels and modulates the expression of pancreatic genes involved in insulin secretion. Regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. Regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. May play a role in ocular development and astrocyte function.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200264 | Hmgn3 (tGFP-tagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594) |
CNY 2,850.00 |
|
MR200264 | Hmgn3 (Myc-DDK-tagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594) |
CNY 1,200.00 |
|
MR200264L3 | Lenti ORF clone of Hmgn3 (Myc-DDK-tagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594) |
CNY 4,750.00 |
|
MR200264L4 | Lenti ORF clone of Hmgn3 (mGFP-tagged) - Mouse high mobility group nucleosomal binding domain 3 (cDNA clone MGC:11574 IMAGE:3597594) |
CNY 4,750.00 |