GALT (NM_000155) Human Untagged Clone

CAT#: SC111633

GALT (untagged)-Human galactose-1-phosphate uridylyltransferase (GALT)



  "NM_000155" in other vectors (4)

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GALT Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000155, the custom clone sequence may differ by one or more nucleotides


ATGTCGCGCAGTGGAACCGATCCTCAGCAACGCCAGCAGGCGTCAGAGGCGGACGCCGCAGCAGCAACCT
TCCGGGCAAACGACCATCAGCATATCCGCTACAACCCGCTGCAGGATGAGTGGGTGCTGGTGTCAGCTCA
CCGCATGAAGCGGCCCTGGCAGGGTCAAGTGGAGCCCCAGCTTCTGAAGACAGTGCCCCGCCATGACCCT
CTCAACCCTCTGTGTCCTGGGGCCATCCGAGCCAACGGAGAGGTGAATCCCCAGTACGATAGCACCTTCC
TGTTTGACAACGACTTCCCAGCTCTGCAGCCTGATGCCCCCAGTCCAGGACCCAGTGATCATCCCCTTTT
CCAAGCAAAGTCTGCTCGAGGAGTCTGTAAGGTCATGTGCTTCCACCCCTGGTCGGATGTAACGCTGCCA
CTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTCAGTCACAGAGGAGCTGGGTGCCC
AGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGCTGTTCTAACCCCCACCCCCACTG
CCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAGCGTGAGGAGCGATCTCAGCAGGCCTATAAG
AGTCAGCATGGAGAGCCCCTGCTAATGGAGTACAGCCGCCAGGAGCTACTCAGGAAGGAACGTCTGGTCC
TAACCAGTGAGCACTGGTTAGTACTGGTCCCCTTCTGGGCAACATGGCCCTACCAGACACTGCTGCTGCC
CCGTCGGCATGTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTGATGATCTAGCCTCCATCATGAAG
AAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTACTCCATGGGCTGGCATGGGGCTC
CCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCACGCTCATTACTACCCTCCGCTCCT
GCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAAATGCTTGCTCAGGCTCAGAGGGACCTCACC
CCTGAGCAGGCTGCAGAGAGACTAAGGGCACTTCCTGAGGTTCATTACCACCTGGGGCAGAAGGACAGGG
AGACAGCAACCATCGCCTGA


Restriction Sites NotI-NotI     
ACCN NM_000155
Insert Size 2480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000155.3, NP_000146.2
RefSeq Size 1407 bp
RefSeq ORF 1140 bp
Locus ID 2592
UniProt ID P07902
Domains GalP_UDP_transf, GalP_UDP_tr_C
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Metabolic pathways
Gene Summary Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...