United States
Germany
Japan
United Kingdom
China
NY-ESO-1 (CTAG1A) (NM_139250) Human Untagged Clone
CAT＃: SC306136
CTAG1A (untagged)-Human cancer/testis antigen 1A (CTAG1A)
CNY 3,840.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT6.1; ESO1; LAGE-2; LAGE2A; NY-ESO-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306136 representing NM_139250.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGGCCGAAGGCCGGGGCACAGGGGGTTCGACGGGCGATGCTGATGGCCCAGGAGGCCCTGGCATT CCTGATGGCCCAGGGGGCAATGCTGGCGGCCCAGGAGAGGCGGGTGCCACGGGCGGCAGAGGTCCCCGG GGCGCAGGGGCAGCAAGGGCCTCGGGGCCGGGAGGAGGCGCCCCGCGGGGTCCGCATGGCGGCGCGGCT TCAGGGCTGAATGGATGCTGCAGATGCGGGGCCAGGGGGCCGGAGAGCCGCCTGCTTGAGTTCTACCTC GCCATGCCTTTCGCGACACCCATGGAAGCAGAGCTGGCCCGCAGGAGCCTGGCCCAGGATGCCCCACCG CTTCCCGTGCCAGGGGTGCTTCTGAAGGAGTTCACTGTGTCCGGCAACATACTGACTATCCGACTGACT GCTGCAGACCACCGCCAACTGCAGCTCTCCATCAGCTCCTGTCTCCAGCAGCTTTCCCTGTTGATGTGG ATCACGCAGTGCTTTCTGCCCGTGTTTTTGGCTCAGCCTCCCTCAGGGCAGAGGCGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_139250 |
| Insert Size | 543 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_139250.1 |
| RefSeq Size | 748 bp |
| RefSeq ORF | 543 bp |
| Locus ID | 246100 |
| UniProt ID | P78358 |
| Protein Families | Druggable Genome |
| MW | 18 kDa |
| Gene Summary | The protein encoded by this gene is a tumor cell antigen found in various types of cancers, which makes it a good candidate for a cancer vaccine. This gene is also highly expressed in normal ovary and testis tissues. An identical copy of this gene is found on the same chromosome. [provided by RefSeq, Dec 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216285 | CTAG1A (Myc-DDK-tagged)-Human cancer/testis antigen 1A (CTAG1A) |
CNY 3,600.00 |
|
| RC216285L1 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC216285L2 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), mGFP tagged |
CNY 5,890.00 |
|
| RC216285L3 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC216285L4 | Lenti ORF clone of Human cancer/testis antigen 1A (CTAG1A), mGFP tagged |
CNY 6,000.00 |
|
| RG216285 | CTAG1A (tGFP-tagged) - Human cancer/testis antigen 1A (CTAG1A) |
CNY 5,200.00 |
其它NY-ESO-1产品
