United States
Germany
Japan
United Kingdom
China
BDNF (NM_001143813) Human Untagged Clone
CAT＃: SC324842
BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 13
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ANON2; BULN2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001143813, the custom clone sequence may differ by one or more nucleotides
ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCC ATGAAAGAAGCAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCAT GGGACTCTGGAGAGCGTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCT GACACTTTCGAACACGTGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAAT GAAGAAAACAATAAGGACGCAGACTTGTACACGTCCAGGGTGATGCTCAGTAGTCAAGTG CCTTTGGAGCCTCCTCTTCTCTTTCTGCTGGAGGAATACAAAAATTACCTAGATGCTGCA AACATGTCCATGAGGGTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTG TGTGACAGTATTAGTGAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCG GGCGGGACGGTCACAGTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATAC TTCTACGAGACCAAGTGCAATCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGAC AAAAGGCATTGGAACTCCCAGTGCCGAACTACCCAGTCGTACGTGCGGGCCCTTACCATG GATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAGACACTTCTTGTGTATGTACA TTGACCATTAAAAGGGGAAGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001143813 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001143813.1, NP_001137285.1 |
| RefSeq Size | 3998 bp |
| RefSeq ORF | 744 bp |
| Locus ID | 627 |
| UniProt ID | P23560 |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Transmembrane |
| Protein Pathways | Huntington's disease, MAPK signaling pathway, Neurotrophin signaling pathway |
| Gene Summary | This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (13), also known as VIa, differs in the 5' UTR and represents use of an alternate promoter compared to variant 1. Variants 1, 2, 4, 5, and 7-16 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227578 | BDNF (Myc-DDK-tagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 13 |
CNY 2,400.00 |
|
| RC227578L3 | Lenti-ORF clone of BDNF (Myc-DDK-tagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 13 |
CNY 5,890.00 |
|
| RC227578L4 | Lenti-ORF clone of BDNF (mGFP-tagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 13 |
CNY 5,890.00 |
|
| RG227578 | BDNF (tGFP-tagged) - Human brain-derived neurotrophic factor (BDNF), transcript variant 13 |
CNY 4,370.00 |
