VLDL Receptor (VLDLR) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA	mBFP-Neo
Symbol	VLDL Receptor
Locus ID	7436
Kit Components	KN211796G1, VLDL Receptor gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGAGCGGCGCCACCGGAAC KN211796G2, VLDL Receptor gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGTCCGCGCTCTGGGCGCTC KN211796BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_001018056, NM_003383, NM_001322225, NM_001322226
Synonyms	CAMRQ1; CARMQ1; CHRMQ1; VLDLRCH
Summary	The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.