Arginyl tRNA synthetase (RARS) (NM_002887) Human 3' UTR Clone

CAT#: SC201068

3' UTR clone of arginyl-tRNA synthetase (RARS) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Arginyl tRNA synthetase (RARS) (NM_002887) Human 3' UTR Clone
Vector pMirTarget
Synonyms ArgRS; DALRD1; HLD9; RARS
ACCN NM_002887
Insert Size 141 bp
Sequence Data
>SC201068 3’UTR clone of NM_002887
The sequence shown below is from the reference sequence of NM_002887. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGAATAAAACCTGTCCAAAGGATGTAATCCTTCATAGGTTTGAACACTGTGTGTTTTTACCAAAGT
GGCCATTGGCACTGTTTGCTTTTTTACAATCATGTGGACACAAGCATAAGTAAAGAAAATTTGTCAACC
AGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002887.4
Synonyms ArgRS; DALRD1; HLD9; RARS
Summary Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Locus ID 5917
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...