Pregnancy zone protein (PZP) (NM_002864) Human 3' UTR Clone

CAT#: SC201200

3' UTR clone of pregnancy-zone protein (PZP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Pregnancy zone protein (PZP) (NM_002864) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPAMD6
ACCN NM_002864
Insert Size 162 bp
Sequence Data
>SC201200 3’UTR clone of NM_002864
The sequence shown below is from the reference sequence of NM_002864. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCACAGATACAGAGCATGGAAATGTTTGAGGACCATACAGGCTGTATATTTTGGTGGATTCTCTGTCC
TATACATTTACTTAGAAGGAATGGAGTTATTTGTCTCTATAAAATAGACACTAAAAATATTTGCTGAAT
AAATATGTACTTCTGGTCAAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002864.3
Synonyms CPAMD6
Summary The protein encoded by this gene is highly expressed in late-pregnancy serum and is similar in structure to alpha-2-macroglobulin. The encoded protein, which acts as a homotetramer, inhibits the activity of all four classes of proteinases. This protein contains cleavage sites for several proteinases. Upon binding of a proteinase, the conformation of this protein changes to trap the proteinase, limiting its activity. This protein appears to be elevated in the sera of presymptomatic Alzheimer's disease patients. [provided by RefSeq, Dec 2016]
Locus ID 5858
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...