MMP16 (NM_022564) Human 3' UTR Clone

CAT#: SC201310

3' UTR clone of matrix metallopeptidase 16 (membrane-inserted) (MMP16) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MMP16 (NM_022564) Human 3' UTR Clone
Vector pMirTarget
Synonyms C8orf57; DKFZp761D112; MMP-X2; MT-MMP2; MT-MMP3; MT3-MMP
ACCN NM_022564
Insert Size 174 bp
Sequence Data
>SC201310 3’UTR clone of NM_022564
The sequence shown below is from the reference sequence of NM_022564. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGAAGAATTATCTTCCATCACATACTAACAAAGAACAATCAGGAATTGAAAATTTAAAATAAAAGGC
CATTTACAATTGCATTCGTAAACACCAAATACCGAGGGATCAATCTGCAAAAAAATGTGCATGACCTCT
ACATTGAAAACAACAAAACACTACTAAATGGTGTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022564.3
Synonyms C8orf57; DKFZp761D112; MMP-X2; MT-MMP2; MT-MMP3; MT3-MMP
Summary Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The encoded protein activates MMP2 by cleavage. This gene was once referred to as MT-MMP2, but was renamed as MT-MMP3 or MMP16. [provided by RefSeq, Oct 2010]
Locus ID 4325
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...