FARS2 (NM_006567) Human 3' UTR Clone

CAT#: SC201458

3' UTR clone of phenylalanyl-tRNA synthetase 2 mitochondrial (FARS2) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FARS2 (NM_006567) Human 3' UTR Clone
Vector pMirTarget
Synonyms COXPD14; FARS1; HSPC320; mtPheRS; PheRS; SPG77
ACCN NM_006567
Insert Size 184 bp
Sequence Data
>SC201458 3’UTR clone of NM_006567
The sequence shown below is from the reference sequence of NM_006567. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCTGTTGGGTGTGGAGGGCAGGTTCTGATGTCACCACTTCACTCAGGCTGCAGCCCTCTTGGGGCTC
CAGGATTTGCTGAAAGAGAAAAAGATATGGTTTGTGAACTGGGGCATCAATCATCTTTTGATAAATGGA
TCAGTTTTAGGACTTTCAGAAAATAAAAGATCGCTCTTGAAAAGCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006567.5
Synonyms COXPD14; FARS1; HSPC320; mtPheRS; PheRS; SPG77
Summary This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 10667
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...