Chemerin (RARRES2) (NM_002889) Human 3' UTR Clone

CAT#: SC201538

3' UTR clone of retinoic acid receptor responder (tazarotene induced) 2 (RARRES2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Chemerin (RARRES2) (NM_002889) Human 3' UTR Clone
Vector pMirTarget
Synonyms HP10433; TIG2
ACCN NM_002889
Insert Size 151 bp
Sequence Data
>SC201538 3’UTR clone of NM_002889
The sequence shown below is from the reference sequence of NM_002889. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTTCTCCAAGGCCCTGCCCCGCAGCTAAGCCAGCACTGAGATGCGTGGTGCCTCCAGGACCGCTGCG
GGTGGTAACCAGTGGAAGACCCCAGCCCCCAGGGAGAGGAACCCGTTCTATCCCCAGCCATGATAATAA
AGCTGCTCTCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002889.4
Synonyms HP10433; TIG2
Summary This gene encodes a secreted chemotactic protein that initiates chemotaxis via the ChemR23 G protein-coupled seven-transmembrane domain ligand. Expression of this gene is upregulated by the synthetic retinoid tazarotene and occurs in a wide variety of tissues. The active protein has several roles, including that as an adipokine and as an antimicrobial protein with activity against bacteria and fungi. [provided by RefSeq, Nov 2014]
Locus ID 5919
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...