ANKRD2 (NM_001129981) Human 3' UTR Clone

CAT#: SC201996

3' UTR clone of ankyrin repeat domain 2 (stretch responsive muscle) (ANKRD2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ANKRD2 (NM_001129981) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARPP
ACCN NM_001129981
Insert Size 189 bp
Sequence Data
>SC201996 3’UTR clone of NM_001129981
The sequence shown below is from the reference sequence of NM_001129981. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGACCCCTCAGCCTGTGCCAGCCCAGTGAATGCGTGCCCCAGCCCAGCCAGCTACCCAGCCCCTCTCT
GTGTGCAGCCGGAGGGTCCTAAGAATGGCTCCCGGAGCTAACTGAGGGCCCAGCCTTTTTTCTGCATGA
TCCAGGAGCACATACCACAAACTACCACAATAAAAAAGCTGTTTTTGCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001129981.3
Synonyms ARPP
Summary This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Locus ID 26287
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...