Relaxin 2 (RLN2) (NM_134441) Human 3' UTR Clone

CAT#: SC202745

3' UTR clone of relaxin 2 (RLN2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Relaxin 2 (RLN2) (NM_134441) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2
ACCN NM_134441
Insert Size 264 bp
Sequence Data
>SC202745 3’UTR clone of NM_134441
The sequence shown below is from the reference sequence of NM_134441. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAAAAGATCTCTTGCTAGATTTTGCTGAGATGAAGCTAATTGTGCACATCTCGTATAATATTCACAC
ATATTCTTAATGACATTTCACTGATGCTTCTATCAGGTCCCATCAATTCTTAGAATATCTAAGAATCTT
TGTTAGATATTAGGTCCCATCAATTCTTAGAATATCTAAACATCTTTGTTGATGTTTAGATTTTTTTAT
TTGATGTGTAAGAAAATGTTCTTTGTGTGATTAAATGACACATTTTTTTGCTGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_134441.3
Synonyms bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2
Summary This gene encodes a member of the relaxin subfamily and insulin superfamily of peptide hormones. In humans there are three non-allelic relaxin genes. This gene encodes multiple protein isoforms, at least one of which undergoes proteolytic processing. This processing generates relaxin A and B chains that are linked by disulfide bonds to form the mature peptide hormone. This hormone plays a role in the male and female reproductive systems and was initially noted for its role in pregnancy. This protein also plays broader roles in the cardiovascular system, including in the regulation of blood pressure and control of heart rate, and data from animal models shows that this protein may have anti-fibrotic and cardioprotective effects. [provided by RefSeq, Jul 2016]
Locus ID 6019
MW 10.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...