IL18 (NM_001562) Human 3' UTR Clone

CAT#: SC204570

3' UTR clone of interleukin 18 (interferon-gamma-inducing factor) (IL18) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IL18 (NM_001562) Human 3' UTR Clone
Vector pMirTarget
Synonyms IGIF; IL-1g; IL-18; IL1F4
ACCN NM_001562
Insert Size 366 bp
Sequence Data
>SC204570 3’UTR clone of NM_001562
The sequence shown below is from the reference sequence of NM_001562. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAATGTTCACTGTTCAAAACGAAGACTAGCTATTAAAATTTCATGCCGGGCGCAGTGGCTCACGCCTG
TAATCCCAGCCCTTTGGGAGGCTGAGGCGGGCAGATCACCAGAGGTCAGGTGTTCAAGACCAGCCTGAC
CAACATGGTGAAACCTCATCTCTACTAAAAATACAAAAAATTAGCTGAGTGTAGTGACGCATGCCCTCA
ATCCCAGCTACTCAAGAGGCTGAGGCAGGAGAATCACTTGCACTCCGGAGGTAGAGGTTGTGGTGAGCC
GAGATTGCACCATTGCGCTCTAGCCTGGGCAACAACAGCAAAACTCCATCTCAAAAAATAAAATAAATA
AATAAACAAATAAAAAATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001562.4
Synonyms IGIF; IL-1g; IL-18; IL1F4
Summary The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020]
Locus ID 3606
MW 13.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...