COASY (NM_001042532) Human 3' UTR Clone

CAT#: SC204659

3' UTR clone of Coenzyme A synthase (COASY) nuclear gene encoding mitochondrial protein transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COASY (NM_001042532) Human 3' UTR Clone
Vector pMirTarget
Synonyms DPCK; NBIA6; NBP; PCH12; pOV-2; PPAT; UKR1
ACCN NM_001042532
Insert Size 339 bp
Sequence Data
>SC204659 3’UTR clone of NM_001042532
The sequence shown below is from the reference sequence of NM_001042532. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTCCCAAGACTCATCAGGCCCTCGACTGAAAAGTTCTCAGTGGGGCCAGACTGGCTCCTGGAGCTGAC
AAGCGACCCCGTGGTGAGGAGAAATGGGGGCCTTGATGCTCACCCTGGTTCAGGCCCAGAGGTCCAAGC
TATACTGTGCAGGACATGGCCAGGCCTGGTGGACACAGGAAGCCTACCCAACACGCTGGTATTTGGCCA
ACACTGAGGATGTGGTTCATGGGGGAGCAGTCCCCTCCCCACTCTTGCCCATGGGTGACTCTTACCCAC
AGCTGACTAGGGCCAGCGCAAATACTGGAACCTGTAACAGAATTAAAGGTGAATGTTCTGAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042532.4
Synonyms DPCK; NBIA6; NBP; PCH12; pOV-2; PPAT; UKR1
Summary Coenzyme A (CoA) functions as a carrier of acetyl and acyl groups in cells and thus plays an important role in numerous synthetic and degradative metabolic pathways in all organisms. In eukaryotes, CoA and its derivatives are also involved in membrane trafficking and signal transduction. This gene encodes the bifunctional protein coenzyme A synthase (CoAsy) which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this bifunctional protein catalyzes the conversion of 4'-phosphopantetheine into dephospho-coenzyme A (dpCoA) while its dephospho-CoA kinase domain completes the final step by phosphorylating dpCoA to form CoA. Mutations in this gene are associated with neurodegeneration with brain iron accumulation (NBIA). Alternative splicing results in multiple isoforms. [provided by RefSeq, Apr 2014]
Locus ID 80347
MW 12.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...