KRT13 (NM_002274) Human 3' UTR Clone

CAT#: SC204939

3' UTR clone of keratin 13 (KRT13) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KRT13 (NM_002274) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK13; K13; WSN2
ACCN NM_002274
Insert Size 393 bp
Sequence Data
>SC204939 3’UTR clone of NM_002274
The sequence shown below is from the reference sequence of NM_002274. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGACGCCAAGAAGCGTCAGCCCCCGTAGCACCTCTGTTACCACGACTTCTAGTGCCTCTGTTACCAC
CACCTCTAATGCCTCTGGTCGCCGCACTTCTGATGTCCGTAGGCCTTAAATCTGCCTGGCGTCCCCTCC
CTCTGTCTTCAGCACCCAGAGGAGGAGAGAGCCGGCAGTTCCCTGCAGGAGAGAGGAGGGGCTGCTGGA
CCCAAGGCTCAGTCCCTCTGCTCTCAGGACCCCCTGTCCTGACTCTCTCCTGATGGTGGGCCCTCTGTG
CTCTTCTCTTCCGGTCGGATCTCTCTCCTCTCTGACCTGGATACGCTTTGGTTTCTCAACTTCTCTACC
CCAAAGAAAAGATTATTCAATAAAGTTTCCTGCCTTTCTGCAAACATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002274.4
Synonyms CK13; K13; WSN2
Summary The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008]
Locus ID 3860
MW 14.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...