Pigx (NM_024464) Mouse Untagged Clone

CAT#: MC200047

Pigx (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1, (10ug)



  "NM_024464" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010319C14Rik; PIG-X
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002202 sequence for NM_024464
GTTCATACCTGCAGTTTTTTTAACACTTGGAAGTAAGAGGCGGGAGAATTGCAGGTTAAAGGCCAACCTG AGCTGCAGAGTAAATTTTAATCCAGCCTTAGCTAACCGGCAGTGATGCTATCAGAAAGTTTTAATATAGA AGCCCCCAACTACTTGTCCAATGAATCTGCAGTCCTCATTTATGCCCGGCAGGATGCACAGTGCATCGAC TGCTTCCAGGCCTTTTTACCTGTGCACTATCGCTATCACCGGCCACATAAGAAAGATGGAGACACCCTCA TTGTGGTCAACAACCCCGACTTACTGATGTACTGTGACCAAGAGTTTCCAATTTTGAAATGCTGGGCTCA GTCAGAAGTAGCAGCTCCTTGTGCTTTGAAGAGTGAGGAGATCTGCCAGTGGAAAAGCATGCAGTACAAA TCAATACTTAAGAATTTGACAGTGCAGGTTCCAGTGGGACTGACTATACATACCTCTTTAGTGTGTTCTG TGACGCTGCTCATTACGATTCTGTGTTCTACTTTGATCCTTTTAGCTGTTTTCAAATATGGCCACTTTTC CCTGTAAGTTTTGTACAGCTAAGTGTTTTCTATGAACCTAATAAATGAGACAAGAGTGCTCTTTTCAGAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_024464
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002202, AAH02202
RefSeq Size 644 bp
RefSeq ORF 453 bp
Locus ID 72084
UniProt ID Q99LV7
Gene Summary This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...