Elf5 (NM_010125) Mouse Untagged Clone
CAT#: MC200780
Elf5 (untagged) - Mouse E74-like factor 5 (Elf5), transcript variant 1, (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | ESE-2; ESE-5; ESE-5. |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021629 sequence for NM_010125
CCACGCGTCCGGCGCGCTTGCCTTCTCTTGCCTTGAAAGCCTTCTGTCTGGACCTAGCCACCACTTGTCT TCACGGTGATGTTGGACTCCGTAACCCATAGCACCTTCCTGCCCAACGCATCCTTCTGTGACCCCCTGAT GCCTTGGACCGATCTGTTCAGCAATGAAGAATACTACCCTGCCTTTGAGCATCAGACAGCCTGTGATTCC TACTGGACATCAGTGCACCCTGAATACTGGACCAAGCGCCACGTCTGGGAATGGCTCCAATTCTGCTGCG ACCAGTACAAGCTTGATGCCAACTGCATCTCCTTCTGTCACTTCAACATCAGCGGCCTGCAGCTCTGCAG CATGACGCAGGAGGAGTTCATTGAGGCAGCCGGCATCTGTGGGGAGTACCTGTACTTCATTCTCCAGAAC ATTCGCTCGCAAGGTTACTCCTTTTTCAATGATGCTGAAGAAACCAAGACTGGCATCAAAGACTATGCTG ATTCCAGTTGCTTGAAAACAAGTGGCATCAAGAGTCAAGACTGTCACAGCCGAACAAGCCTCCAAAGTTC TCACCTGTGGGAATTTGTCAGAGACTTGCTGCTGTCCCCTGAAGAGAACTGTGGCATCCTGGAATGGGAA GACAGGGAGCAGGGCATTTTCCGAGTGGTTAAGTCAGAAGCCCTGGCAAAGATGTGGGGACAAAGGAAGA AGAATGACAGGATGACGTACGAGAAGCTGAGCCGAGCCCTGAGATACTACTATAAAACGGGAATTCTGGA GCGGGTTGACCGGAGGTTAGTGTACAAATTTGGAAAGAACGCGCACGGGTGGCAGGAAGAGAAACTCTGA TGGACACCGGACACCAGGCTCATTTGATGGATTTCTGTTGTTTGAAACAATCAGATCAAACTAGGCATTT GAAAGTCTCCCTCCTCCTCCTCCTCCCCCTCCTTCCCCTCCTCTTCTTCCTCCCCCTCCTCCTCTTCAAA ACCTACAAACACACTGATAAAATTTCTGCATGTCTCAGCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010125 |
Insert Size | 762 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC021629, AAH21629 |
RefSeq Size | 1119 bp |
RefSeq ORF | 762 bp |
Locus ID | 13711 |
UniProt ID | Q8VDK3 |
Gene Summary | Transcriptionally activator that may play a role in regulating the later stages of keratinocytes terminal differentiation (By similarity). Binds to DNA sequences containing the consensus nucleotide core sequence GGA[AT]. Transcriptionally activates the TK promoter.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203230 | Elf5 (tGFP-tagged) - Mouse E74-like factor 5 (Elf5) |
CNY 4,000.00 |
|
MR203230 | Elf5 (Myc-DDK-tagged) - Mouse E74-like factor 5 (Elf5), transcript variant 1 |
CNY 2,400.00 |
|
MR203230L3 | Lenti ORF clone of Elf5 (Myc-DDK-tagged) - Mouse E74-like factor 5 (Elf5), transcript variant 1 |
CNY 4,750.00 |
|
MR203230L4 | Lenti ORF clone of Elf5 (mGFP-tagged) - Mouse E74-like factor 5 (Elf5), transcript variant 1 |
CNY 4,800.00 |