United States
Germany
Japan
United Kingdom
China
Atpif1 (NM_007512) Mouse Untagged Clone
CAT＃: MC200851
Atpif1 (untagged) - Mouse ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATP5IF1; Atpi; If; IF(1); If1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012680 sequence for NM_007512
CCACGCGTCCGGTTCAGCCGCCCTCGCAGTTAGCGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAG CTGAGCAACGCCGAAGACAATGGCAGGCTCGGCGTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATG AAGGTCCTGCAAACCCGAGGCTTCGTCTCGGACTCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCC GAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAA AGAACAGCTGGCTGCCCTGAGGAAACACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGT CTGCAGAAGCAAATTGAACGCCATAAGAAGAAGATCCAACAACTAAAGAATAATCATTGAATGCGCGCAG TCGGTCCCTCACAGAGTGGCCCGTATCACTCCCCACGTCTGTAGACACATGGCTTTGAATGATTACTATT TGGTCTGTGTGCTACTAACAGATAATAAACGATCACCAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007512 |
| Insert Size | 321 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012680, AAH12680 |
| RefSeq Size | 610 bp |
| RefSeq ORF | 321 bp |
| Locus ID | 11983 |
| UniProt ID | O35143 |
| Gene Summary | This gene encodes a member of the ATPase inhibitor family of proteins. This protein has been shown to negatively regulate the ATP hydrolysis activity of the F1Fo-ATPase. Knockdown of this gene is associated with reduced heme synthesis in differentiating erythroid cells. Misregulation of this gene has been found to lead to increased aerobic glycolysis in mouse cancer cells, while high expression levels of this gene have been correlated with gastric and liver cancer severity in human patients. A pseudogene of this gene has been identified. [provided by RefSeq, Apr 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200378 | Atpif1 (tGFP-tagged) - Mouse ATPase inhibitory factor 1 (Atpif1) |
CNY 2,850.00 |
|
| MR200378 | Atpif1 (Myc-DDK-tagged) - Mouse ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
| MR200378L3 | Lenti ORF clone of Atpif1 (Myc-DDK-tagged) - Mouse ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR200378L4 | Lenti ORF clone of Atpif1 (mGFP-tagged) - Mouse ATPase inhibitory factor 1 (Atpif1), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
