Ercc1 (NM_007948) Mouse Untagged Clone

CAT#: MC200987

Ercc1 (untagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1), transcript variant 1, (10ug)



  "NM_007948" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Ercc1 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ercc-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011224 sequence for NM_007948
GAAGTGAGTCTAGCAGGAGTTGTGCTGGCTGTGCTGGCGTTGTGTCGCCTCTGTTTCCCCCCGTGGTATT TCCTTCTAGGCATCGGGAAAGACCAGGCCCCAGATGGACCCTGGGAAGGACGAGGAAAGTCGGCCACAGC CCTCAGGACCACCCACCAGGAGGAAGTTTGTTATCCCACTGGAGGAAGAAGAGGTGCCCTGTGCAGGGGT CAAGCCCTTATTCAGATCGTCACGGAATCCCACCATCCCAGCAACCTCAGCCCACGTGGCCCCTCAGACG TATGCTGAGTACGCCATCACCCAGCCTCCAGGAGGGGCTGGGGCCACAGTGCCCACAGGCTCTGAACCTG CGGCAGGAGAGAACCCCAGCCAGACCCTGAAAACAGGAGCAAAGTCTAATAGCATCATCGTGAGCCCGAG GCAGAGGGGCAACCCCGTGTTGAAGTTTGTGCGCAATGTGCCCTGGGAATTCGGTGAGGTGATTCCCGAT TATGTGCTGGGCCAGAGCACCTGCGCCCTTTTCCTCAGCCTCCGCTACCACAACCTCCATCCAGACTACA TCCATGAACGGCTGCAGAGCCTGGGGAAGAACTTCGCCCTTCGTGTGCTGCTGGTTCAAGTGGATGTGAA AGATCCCCAGCAGGCTCTCAAGGAGCTGGCTAAGATGTGCATCTTGGCTGACTGCACCCTGGTCCTGGCC TGGAGTGCAGAGGAAGCAGGGCGGTACCTGGAGACCTACAAGGCGTATGAGCAGAAGCCAGCCGACCTCC TTATGGAAAAGCTGGAGCAGAACTTCCTATCACGGGCCACTGAGTGTCTGACCACCGTGAAATCTGTGAA CAAGACCGACAGCCAGACCCTCCTGGCTACATTTGGATCCCTGGAACAGCTCTTCACCGCATCAAGGGAG GATCTAGCCTTATGCCCGGGCCTGGGCCCACAGAAGGCCCGCAGGCTCTTTGAAGTACTACACGAACCCT TCCTCAAAGTGCCTCGATGACCTGCTGCCACCTAGGCCCAGTGTCACAATAAAGAATTTTCCATGCCCAG GCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007948
Insert Size 897 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011224, AAH11224
RefSeq Size 1067 bp
RefSeq ORF 897 bp
Locus ID 13870
UniProt ID P07903
Gene Summary Non-catalytic component of a structure-specific DNA repair endonuclease responsible for the 5'-incision during DNA repair. Responsible, in conjunction with SLX4, for the first step in the repair of interstrand cross-links (ICL). Participates in the processing of anaphase bridge-generating DNA structures, which consist in incompletely processed DNA lesions arising during S or G2 phase, and can result in cytokinesis failure. Also required for homology-directed repair (HDR) of DNA double-strand breaks, in conjunction with SLX4 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...