Hyi (NM_026601) Mouse Untagged Clone
CAT#: MC201509
Hyi (untagged) - Mouse hydroxypyruvate isomerase homolog (E. coli) (Hyi), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2700033B16Rik; 6430559E15Rik; HT036 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024619 sequence for NM_026601
CTCGCCGCCGCCTTCTGCTCGCATGGCTCCGCTCCGCTTTTCGGCCAACGTCTCCTGGCTGTTTCCAGAG CTCCCCGGGCTCCCCGAGCGGCTGCACGCCGCGGGCCGTGCGGGCTTCAAAGCGGCCGAGGTGGCCTGGC CGTACACTGAGTCCCCCCAGGCGCTGGCGAGCGCGGCGCAGACTGCGGGACTGCGGCTGGTGCTCATCAA CACGCCGCGGGGAGACCATGAGAAGGGGGAGATGGGGCTGGGGGCCGTCCCCGGGAGACAGGCGGCCTTC CGAGAGGGGCTGGAGCAGGCTGTGCTGTATGCCAAGGCTCTGGGCTGCCCCAGGATCCACCTGATGGCTG GCCGAGTACCCCAAGGGGCTGACCGGGCTGCAGTCAAGGGGGAGATGGAGGCGGTTTTTGTGGAGAATCT GAAGCATGCAGCTGGCGTTCTGGCTCAGGAGAACCTCGTGGGACTGCTGGAGCCCATCAACACCCGCATC ACAGACCCCCAGTATTTCCTGGACACACCCCGGCAAGCGGCAGCCATCTTGCAGAAGGTTGGGAGACCCA ATCTGCAGTTGCAGATGGACATATTCCACTGGCAGATCATGGATGGGAATCTCACAGGAAACATCAGGGA GTTTCTGCCCACTGTCGGGCATGTGCAAGTGGCCCAGGTCCCAGACCGTGGGGAGCCAAGCAGTTCTGGA GAGCTAGACTTTACTTACCTGTTTCAGCTGCTAGAAGATGAGGGCTACCAAGGATTTGTGGGTTGCGAGT ATCGGCCTCGAGGAGACACAGTGGAGGGTCTGAGTTGGCTACGTTCATACTGGGACAGGCGGGGCCACCC ACGGACTGGCCAGTAAGGTTCTGCACAGCACCTGCATGCTGCCCTGGGGCGGTGTGCTAGTGTCCGGAGT CCCCTCCTCTGAATTAAAATCACACTGAGCGTTAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026601 |
Insert Size | 834 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024619, AAH24619 |
RefSeq Size | 959 bp |
RefSeq ORF | 834 bp |
Locus ID | 68180 |
UniProt ID | Q8R1F5 |
Gene Summary | Catalyzes the reversible isomerization between hydroxypyruvate and 2-hydroxy-3-oxopropanoate (also termed tartronate semialdehyde).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the coding variant that is expressed in some strains, including FBV/N, CZECHII, and CD-1. Sequence Note: This RefSeq record was created to represent the transcript and the full-length, functional protein that is expressed in several strains. It does not contain a short deletion that causes a frameshift in the coding region of the strain of the reference genome, C57BL/6J. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203722 | Hyi (tGFP-tagged) - Mouse hydroxypyruvate isomerase homolog (E. coli) (Hyi) |
CNY 2,850.00 |
|
MR203722 | Hyi (Myc-DDK-tagged) - Mouse hydroxypyruvate isomerase homolog (E. coli) (Hyi) |
CNY 2,400.00 |
|
MR203722L3 | Lenti ORF clone of Hyi (Myc-DDK-tagged) - Mouse hydroxypyruvate isomerase homolog (E. coli) (Hyi) |
CNY 4,750.00 |
|
MR203722L4 | Lenti ORF clone of Hyi (mGFP-tagged) - Mouse hydroxypyruvate isomerase homolog (E. coli) (Hyi) |
CNY 4,750.00 |