Gtf2h5 (NM_181392) Mouse Untagged Clone
CAT#: MC202230
Gtf2h5 (untagged) - Mouse general transcription factor IIH, polypeptide 5 (Gtf2h5), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2700017P07Rik; 2810432H05Rik; D17Wsu155e |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029238 sequence for NM_181392
CCGGGCCAGCTCTGGTTTGTTGGAGTTGGAACGCTGCTGCCTCTGCGCGCCTAGAAAAAGAATTCTTGAA GTCATCTGCACCGTCTGCCTGGGAAAAGATGGTCAACGTGCTGAAAGGGGTGCTTATAGAATGTGACCCT GCCATGAAGCAGTTCTTGCTGTACTTGGATGAGGCCAACGCCTTGGGGAAGAAGTTCATCATTCAGGACA TTGATGACACGCACGTCTTCGTCATTGCCGAGCTGGTCAACGTCCTCCAGGAGCGAGTAGGGGAACTGAT GGACCAGAATGCCTTTTCTCTTACCCAGAAGTGAGAGCGCTGGTGTTGAGCACTTGGGAATCCCAGCCAC AGACACTTGAGAGAGGCCAGCTCAGTGTCTCGTGGGGTTTATACTTGTTATGAGCATGTCGTGGGAAAGG CTGCAGGGTCATTCATTCAGATGAAAGCCCCTAACTGATTTGGTTGGACCATTAAAAAAAAAATATGTGT ACAGAAGAACTTTAGCTGCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_181392 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC029238, AAH29238 |
RefSeq Size | 524 bp |
RefSeq ORF | 216 bp |
Locus ID | 66467 |
UniProt ID | Q8K2X8 |
Gene Summary | Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II. In NER, TFIIH acts by opening DNA around the lesion to allow the excision of the damaged oligonucleotide and its replacement by a new DNA fragment. In transcription, TFIIH has an essential role in transcription initiation. When the pre-initiation complex (PIC) has been established, TFIIH is required for promoter opening and promoter escape. Phosphorylation of the C-terminal tail (CTD) of the largest subunit of RNA polymerase II by the kinase module CAK controls the initiation of transcription. Necessary for the stability of the TFIIH complex and for the presence of normal levels of TFIIH in the cell.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200081 | Gtf2h5 (tGFP-tagged) - Mouse general transcription factor IIH, polypeptide 5 (Gtf2h5) |
CNY 2,850.00 |
|
MR200081 | Gtf2h5 (Myc-DDK-tagged) - Mouse general transcription factor IIH, polypeptide 5 (Gtf2h5) |
CNY 1,200.00 |
|
MR200081L3 | Lenti ORF clone of Gtf2h5 (Myc-DDK-tagged) - Mouse general transcription factor IIH, polypeptide 5 (Gtf2h5) |
CNY 4,750.00 |
|
MR200081L4 | Lenti ORF clone of Gtf2h5 (mGFP-tagged) - Mouse general transcription factor IIH, polypeptide 5 (Gtf2h5) |
CNY 4,750.00 |