United States
Germany
Japan
United Kingdom
China
Smarcb1 (NM_011418) Mouse Untagged Clone
CAT＃: MC203183
Smarcb1 (untagged) - Mouse SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (Smarcb1), transcript variant 1, (10ug)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AU020204; Baf47; Ini1; Snf5; SNF5/INI1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC025163
GAGACGGCCAAGGAGCCCAGTAGTGACACGAGCGCTCGCCCGGTTCGCCCGGCTTGCCCTGCCCGACCTT CACCTCCAGGCCTCCGTTCCTTTCGGTCCGACGCGCCTCGGCCCCGCCCTAGCCCACCGGATTCTTTCCA GCTCGACCCCGGCTGCCGGTTTCCCCCGCCGCCATGATGATGATGGCGTTGAGCAAGACCTTCGGGCAGA AGCCCGTCAAGTTTCAGCTGGAGGACGACGGGGAGTTCTACATGATCGGCTCCGAGGTGGGAAACTACCT GCGTATGTTCCGAGGTTCTCTGTACAAGAGATACCCCTCACTCTGGCGGCGACTAGCCACTGTGGAAGAA AGGAAGAAAATAGTGGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCATGGATATACCA CCCTGGCCACCAGCGTGACACTCCTGAAAGCCTCAGAGGTAGAAGAGATCCTGGATGGCAATGACGAGAA GTACAAGGCTGTGTCCATCAGCACAGAGCCCCCGACCTACCTCAGGGAGCAGAAGGCCAAGAGGAACAGC CAGTGGGTCCCCACCCTGCCCAACAGCTCCCACCACCTGGATGCTGTGCCCTGTTCCACCACCATCAACA GGAACCGCATGGGTCGGGACAAGAAGAGAACCTTCCCCTTGTGCTTTGATGACCACGACCCAGCTGTGAT CCATGAGAATGCGTCACAGCCTGAGGTGCTGGTGCCCATCCGGCTCGACATGGAGATCGACGGGCAGAAG CTGCGAGACGCTTTTACCTGGAACATGAATGAGAAGCTAATGACTCCTGAGATGTTTTCAGAAATACTTT GTGATGACCTGGATTTGAATCCACTGACTTTTGTGCCAGCTATTGCCTCTGCCATTCGACAGCAGATTGA GTCCTACCCCACAGACAGCATCCTAGAGGATCAATCCGACCAGCGTGTCATCATCAAGCTGAACATCCAC GTGGGGAACATCTCCCTGGTGGACCAGTTTGAGTGGGACATGTCAGAGAAAGAGAACTCCCCAGAGAAGT TTGCCCTGAAGCTGTGCTCAGAGCTGGGCTTGGGCGGGGAGTTTGTCACCACCATTGCATACAGCATCCG AGGACAGCTGAGCTGGCACCAGAAGACCTATGCCTTCAGTGAGAACCCACTTCCCACAGTGGAGATTGCC ATCCGAAATACCGGAGATGCTGACCAGTGGTGCCCCCTGCTGGAGACACTGACTGATGCCGAGATGGAGA AAAAGATCCGGGATCAAGATAGGAACACAAGGCGAATGAGGCGTCTTGCCAACACTGCCCCAGCCTGGTG ATGAAGACATCCATGCTCGACCTCTACGGAGCATCTCAGACTGCCTTTCCTTCCTCTGTGGAAAGAGAAA GGCAAAGGGACAGCTGGTGCCATCCTGAGGACTGGGGTAGGAGCCTCCTAGGTGCCTCCCTTCAGCACAC ATTCCATTTGCTAAACCCCAACACTGTCCCCCAGAGTCTAGAGTCGGAAGCAGCCTCATTTTGGGTTGTG TTTTGTTTTTGTATAGGAGCCCAGGCAGGGCTGGTAACACTTTTTAAATAAAAAGTACCATGTTCAAAAA AAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_011418 |
| Insert Size | 1158 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC025163, AAH25163 |
| RefSeq Size | 1620 bp |
| RefSeq ORF | 1158 bp |
| Locus ID | 20587 |
| UniProt ID | Q9Z0H3 |
| Gene Summary | Core component of the BAF (SWI/SNF) complex. This ATP-dependent chromatin-remodeling complex plays important roles in cell proliferation and differentiation, in cellular antiviral activities and inhibition of tumor formation. The BAF complex is able to create a stable, altered form of chromatin that constrains fewer negative supercoils than normal. This change in supercoiling would be due to the conversion of up to one-half of the nucleosomes on polynucleosomal arrays into asymmetric structures, termed altosomes, each composed of 2 histones octamers. Stimulates in vitro the remodeling activity of SMARCA4/BRG1/BAF190A. Plays a key role in cell-cycle control and causes cell cycle arrest in G0/G1. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG206006 | Smarcb1 (tGFP-tagged) - Mouse SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (Smarcb1) |
CNY 7,088.00 |
|
| MR206006 | Smarcb1 (Myc-DDK-tagged) - Mouse SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (Smarcb1), transcript variant 1 |
CNY 5,488.00 |
|
| MR206006L3 | Lenti ORF clone of Smarcb1 (Myc-DDK-tagged) - Mouse SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (Smarcb1), transcript variant 1 |
CNY 5,890.00 |
|
| MR206006L4 | Lenti ORF clone of Smarcb1 (mGFP-tagged) - Mouse SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (Smarcb1), transcript variant 1 |
CNY 5,890.00 |
其它Smarcb1产品
