Immp2l (NM_053122) Mouse Untagged Clone

CAT#: MC205005

Immp2l (untagged) - Mouse IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (Immp2l), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_053122" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI853880; IMP2; Tg(HLA-A/H2-D)2Enge
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC100557
CGCAGCGGGATTTTGGCCAAATTGGGCGAGGGTACAATATTACCACTTACCCCTTCTCACCGAGGAAGAG CGGGAGAAAGGGTATGGCACAGTCACAAAGCTGGGCGAGAAGATGCTTCAAGGCCTTTTGCAAAGGCTTC TTCGTGGCGGTGCCCGTGGCAGTCACTTTCTTGGATCGCGTGGCCTGCGTGGCTCGGGTGGAAGGCTCGT CAATGCAGCCTTCTTTGAATCCTGGAGGAAGCCAGTCCTCAGATGTGGTACTTTTGAACCACTGGAAAGT GAGAAATTTTGAAGTACAGCGTGGTGACATTGTGTCATTGGTCTCTCCTAAAAACCCAGAACAGAAAATC ATTAAGAGAGTGATCGCTCTTGAAGGAGATATTGTAAGAACAATTGGACACAAAAACCGGTTGGTCAAAG TCCCCCGCGGTCACATGTGGGTTGAAGGCGATCATCATGGACACAGTTTTGATAGTAATTCTTTTGGACC GGTTTCTCTGGGACTCCTGCATGCCCATGCCACACATATTTTGTGGCCTCCAGAGCGCTGGCAGAGACTG GAATCTGTTCTTCCTCCAGAGCGCTGTCCACTCCAGACTGGTGAGAAATAACTGCACAAGAGCCCACCAT AGGAGGAGCTGAACACACCAGATGCCTCCTTCTGGAGGGAGATGTTCCAGTGATGCTGAACACAAGACCT CTGTATATCTTTAAGGTTGTCTGGAATTTCCATATTAAACAGTATTAAATGGCAAAAAAAAAAAAAAAAA AAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_053122
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC100557, AAI00558
RefSeq Size 776 bp
RefSeq ORF 528 bp
Locus ID 93757
UniProt ID Q8BPT6
Gene Summary Catalyzes the removal of transit peptides required for the targeting of proteins from the mitochondrial matrix, across the inner membrane, into the inter-membrane space. Known to process the nuclear encoded protein DIABLO (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...