Pfdn6 (NM_010385) Mouse Untagged Clone
CAT#: MC205799
H2 (untagged) - Mouse H2-K region expressed gene 2 (H2-Ke2), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | H-2Ke2; H2-Ke2; Ke-2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC022974
AGAGCGTGAAGAGGTTAGCGTTTGGCTTGGAGGGTTCGGGGATCTCTTCTTTCGCTCTCCTTTGCCTAGG GAGTGGCTATTCTGGACGAAAAGAGGCTGCGGCGCCTCGGAGAGTTGCGGGTAGAAAGTGCTGTCCTTCT GCAGGGTCAGGGAGGGGGGATTCAGGTGCCTCCCAGAGCTTGAGACCCAGCGACCCCCGCCCAGGAGGCT TTCTCCTTCACCATGGCTGAACTGATCCAAAAGAAGCTGCAGGGAGAGGTAGAGAAATATCAACAGCTGC AGAAGGACTTGAGTAAATCTATGTCAGGGAGGCAGAAGCTCGAAGCACAGCTAACGGAAAACAATATCGT GAAGGAGGAGCTGGCCCTGCTGGATGGATCCAACGTGGTCTTTAAGCTTCTGGGACCCGTGCTTGTCAAA CAGGAGCTGGGGGAGGCTCGGGCCACAGTAGGGAAGAGGCTAGACTACATCACAGCAGAAATCAAGCGCT ACGAATCACAGCTTCGGGACCTCGAGCGGCAGTCAGAGCAACAGAGGGAAACCCTTGCCCAACTGCAGCA GGAGTTCCAGCGGGCCCAAGCTGCAAAGGCTCCTGGGAAAGCCTGACTCCGTGGGAGGGGGTCAGGAGGG AGGGATGAGGCTAACCCTGAGCCAATAAAATGTAAACAGAACCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010385 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC022974, AAH22974 |
RefSeq Size | 688 bp |
RefSeq ORF | 384 bp |
Locus ID | 14976 |
UniProt ID | Q03958 |
Gene Summary | Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. Binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200682 | H2 (tGFP-tagged) - Mouse H2-K region expressed gene 2 (H2-Ke2) |
CNY 2,850.00 |
|
MR200682 | H2 (Myc-DDK-tagged) - Mouse H2-K region expressed gene 2 (H2-Ke2), transcript variant 1 |
CNY 1,200.00 |
|
MR200682L3 | Lenti ORF clone of H2 (Myc-DDK-tagged) - Mouse H2-K region expressed gene 2 (H2-Ke2), transcript variant 1 |
CNY 4,750.00 |
|
MR200682L4 | Lenti ORF clone of H2 (mGFP-tagged) - Mouse H2-K region expressed gene 2 (H2-Ke2), transcript variant 1 |
CNY 4,750.00 |