United States
Germany
Japan
United Kingdom
China
Cryaa (BC092385) Mouse Untagged Clone
CAT＃: MC206827
Cryaa (untagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480), (10ug)
CNY 3,230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Acry-1; Crya-1; Crya1; DAcry-1; lop18 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206827 representing BC092385.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGTCACCATTCAGCATCCTTGGTTCAAGCGTGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTC GACCAGTTCTTCGGCGAGGGCCTTTTTGAGTACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCC TACTACCGCCAGTCCCTCTTCCGCACTGTGCTGGACTCGGGCATCTCTGAGGTCCGATCTGACCGGGAC AAGTTTGTCATCTTCTTGGACGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAGGAT TTTGTGGAGATTCACGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCAC CGTCGCTACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCCTGTCTGCGGATGGCATG CTGACCTTCTCTGGCCCCAAGGTCCAGTCCGGTTTGGATGCTGGCCACAGCGAGAGGGCCATTCCTGTG TCACGGGAGGAGAAACCCAGCTCTGCACCCTCGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC092385 |
| Insert Size | 522 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC092385 |
| RefSeq Size | 1112 bp |
| RefSeq ORF | 521 bp |
| Locus ID | 12954 |
| MW | 19.8 kDa |
| Gene Summary | This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201482 | Cryaa (tGFP-tagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480) |
CNY 2,850.00 |
|
| MR201482 | Cryaa (Myc-DDK-tagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480) |
CNY 2,400.00 |
|
| MR201482L3 | Lenti ORF clone of Cryaa (Myc-DDK-tagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480) |
CNY 4,750.00 |
|
| MR201482L4 | Lenti ORF clone of Cryaa (mGFP-tagged) - Mouse crystallin, alpha A (cDNA clone MGC:106604 IMAGE:30602480) |
CNY 4,750.00 |
