Elob (NM_026305) Mouse Untagged Clone

CAT#: MC207633

Tceb2 (untagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2), (10ug)



  "NM_026305" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610040H15Rik; Tceb2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207633 representing NM_026305
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTGTTTCTCATGATCCGGCGCCACAAGACCACCATCTTTACGGACGCCAAGGAGTCGAGCACCG
TGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCGCCAGAGGAGCAGCGGCTTTACAAGGA
TGACCAGCTCCTTGATGATGGCAAAACTCTGGGCGAGTGTGGCTTCACTAGCCAGACAGCACGGCCACAG
GCCCCAGCCACAGTGGGCCTGGCCTTCCGAGCAGATGACACCTTCGAAGCTCTCCGCATCGAGCCCTTTT
CCAGCCCTCCAGAGCTTCCAGATGTGATGAAGCCACAGGATTCTGGAGGCAGTGCCAATGAACAAGCTGT
GCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026305
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_026305.2, NP_080581.1
RefSeq Size 508 bp
RefSeq ORF 357 bp
Locus ID 67673
UniProt ID P62869
Gene Summary SIII, also known as elongin, is a general transcription elongation factor that increases the RNA polymerase II transcription elongation past template-encoded arresting sites. Subunit A is transcriptionally active and its transcription activity is strongly enhanced by binding to the dimeric complex of the SIII regulatory subunits B and C (elongin BC complex) (By similarity). In embryonic stem cells, the elongin BC complex is recruited by EPOP to Polycomb group (PcG) target genes in order generate genomic region that display both active and repressive chromatin properties, an important feature of pluripotent stem cells (PubMed:27863225, PubMed:27863226).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...