Fcer1a (NM_010184) Mouse Untagged Clone

CAT#: MC208469

Fcer1a (untagged) - Mouse Fc receptor, IgE, high affinity I, alpha polypeptide (Fcer1a), (10ug)



  "NM_010184" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Recombinant Anti-FceR1 alpha (Clone Mar-1)
    • 200 ug

CNY 6,881.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Fce1a; fcepsilonri; FcERI; Fcr-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_010184, the custom clone sequence may differ by one or more nucleotides


ATGGTCACTGGAAGGTCTGCCCAGCTGTGCCTAGCACTGCTGTTCATGTCTCTTGATGTCATTCTGACAG
CCACTGAGAAATCTGTACTGACCTTGGACCCACCATGGATTAGAATATTTACAGGAGAGAAAGTGACCCT
TTCCTGCTATGGGAACAATCACCTTCAAATGAACTCTACTACTAAATGGATCCACAATGGTACCGTCTCT
GAGGTGAACTCTTCACATTTGGTCATTGTGAGTGCCACCGTTCAAGACAGTGGAAAATACATATGTCAGA
AGCAAGGATTGTTTAAGAGTAAACCTGTGTACTTGAATGTAACGCAAGATTGGCTGCTCCTTCAGACATC
TGCTGACATGGTCTTAGTCCATGGATCCTTTGACATCAGATGCCATGGCTGGAAGAACTGGAATGTCCGC
AAGGTGATCTACTACAGGAATGACCATGCTTTCAACTACAGTTATGAGAGCCCCGTCTCCATTAGAGAGG
CCACACTGAATGACAGTGGCACCTACCACTGCAAGGGCTATCTTAGGCAGGTGAAATATGAATCTGACAA
ATTCAGAATTGCTGTAGTAAAAGCTTACAAATGCAAGTATTATTGGCTACAACTAATTTTCCCATTGTTG
GTGGCGATTCTGTTTGCTGTGGACACGGGGTTATTGCTCTCAACCGAAGAACAGTTCAAATCAGTCTTGG
AGATTCAGAAGACTGGAAAATACAAGAAAGTTGAAACCGAACTCCTAACCTAG


Restriction Sites SgfI-MluI     
ACCN NM_010184
Insert Size 753 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC125455, AAI25456
RefSeq Size 869 bp
RefSeq ORF 753 bp
Locus ID 14125
UniProt ID P20489
Gene Summary Binds to the Fc region of immunoglobulins epsilon. High affinity receptor. Responsible for initiating the allergic response. Binding of allergen to receptor-bound IgE leads to cell activation and the release of mediators (such as histamine) responsible for the manifestations of allergy. The same receptor also induces the secretion of important lymphokines.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...