United States
Germany
Japan
United Kingdom
China
Ube2b (NM_009458) Mouse Untagged Clone
CAT＃: MC209613
Ube2b (untagged) - Mouse ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae) (Ube2b), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2610301N02Rik; E2-14k; HR6B; mHR6B; Rad6b |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209613 representing NM_009458
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGACCCCGGCCCGTAGGAGGCTCATGCGGGATTTCAAGCGATTGCAAGAGGACCCACCTGTGGGGG TCAGTGGCGCCCCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACC CTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACCGTT AGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTGCAGA ATCGATGGAGTCCCACATATGATGTCTCTTCCATCTTAACTTCCATTCAGTCTCTGCTGGATGAACCGAA TCCAAACAGTCCAGCCAACAGCCAAGCAGCACAGCTTTATCAGGAAAACAAACGGGAGTATGAGAAGAGA GTTTCGGCCATTGTTGAGCAAAGCTGGAATGATTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009458 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_009458.4, NP_033484.3 |
| RefSeq Size | 2141 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 22210 |
| UniProt ID | P63147 |
| Gene Summary | Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In association with the E3 enzyme BRE1 (RNF20 and/or RNF40), it plays a role in transcription regulation by catalyzing the monoubiquitination of histone H2B at 'Lys-120' to form H2BK120ub1. H2BK120ub1 gives a specific tag for epigenetic transcriptional activation, elongation by RNA polymerase II, telomeric silencing, and is also a prerequisite for H3K4me and H3K79me formation. In vitro catalyzes 'Lys-11'-, as well as 'Lys-48'- and 'Lys-63'-linked polyubiquitination. Required for postreplication repair of UV-damaged DNA. Associates to the E3 ligase RAD18 to form the UBE2B-RAD18 ubiquitin ligase complex involved in mono-ubiquitination of DNA-associated PCNA on 'Lys-164'. May be involved in neurite outgrowth.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226043 | Ube2b (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2B RAD6 homology (S. cerevisiae) (Ube2b), (10ug) |
CNY 2,800.00 |
|
| MR226043 | Ube2b (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae) (Ube2b) |
CNY 1,200.00 |
|
| MR226043L3 | Lenti ORF clone of Ube2b (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae) (Ube2b) |
CNY 4,750.00 |
|
| MR226043L4 | Lenti ORF clone of Ube2b (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae) (Ube2b) |
CNY 4,750.00 |
