Spo11 (NM_001083959) Mouse Untagged Clone

CAT#: MC209758

Spo11 (untagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 3, (10ug)



  "NM_001083959" in other vectors (4)

CNY 3,656.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
SPO11 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI449549; Spo11a; Spo11b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209758 representing NM_001083959
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001083959
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001083959.1, NP_001077428.1
RefSeq Size 1641 bp
RefSeq ORF 1116 bp
Locus ID 26972
UniProt ID Q9WTK8
Gene Summary Isoform 1: Component of a topoisomerase 6 complex specifically required for meiotic recombination. Together with TOP6BL, mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination (PubMed:26917764). The complex promotes relaxation of negative and positive supercoiled DNA and DNA decatenation through cleavage and ligation cycles. Essential for the phosphorylation of SMC3, HORMAD1 and HORMAD2 (PubMed:22346761).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region and uses an alternate in-frame splice site in an internal exon compared to variant 1. The encoded isoform (c) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...