Spo11 (NM_001083959) Mouse Untagged Clone
CAT#: MC209758
Spo11 (untagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 3, (10ug)
CNY 3,656.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI449549; Spo11a; Spo11b |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209758 representing NM_001083959
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001083959 |
Insert Size | 1116 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001083959.1, NP_001077428.1 |
RefSeq Size | 1641 bp |
RefSeq ORF | 1116 bp |
Locus ID | 26972 |
UniProt ID | Q9WTK8 |
Gene Summary | Isoform 1: Component of a topoisomerase 6 complex specifically required for meiotic recombination. Together with TOP6BL, mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination (PubMed:26917764). The complex promotes relaxation of negative and positive supercoiled DNA and DNA decatenation through cleavage and ligation cycles. Essential for the phosphorylation of SMC3, HORMAD1 and HORMAD2 (PubMed:22346761).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region and uses an alternate in-frame splice site in an internal exon compared to variant 1. The encoded isoform (c) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226169 | Spo11 (tGFP-tagged) - Mouse sporulation protein meiosis-specific SPO11 homolog (S. cerevisiae) (Spo11) transcript variant 3, (10ug) |
CNY 3,140.00 |
|
MR226169 | Spo11 (Myc-DDK-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 3 |
CNY 3,656.00 |
|
MR226169L3 | Lenti ORF clone of Spo11 (Myc-DDK-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 3 |
CNY 4,750.00 |
|
MR226169L4 | Lenti ORF clone of Spo11 (mGFP-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 3 |
CNY 4,750.00 |