Slurp1 (NM_020519) Mouse Untagged Clone
CAT#: MC210135
Slurp1 (untagged) - Mouse secreted Ly6/Plaur domain containing 1 (Slurp1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110021N19Rik; AI415082; ARS; ArsB; Slurp-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210135 representing NM_020519
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCCTTCGCTGGGCCATGTGGCTGCTGCTCTTGGCAGCCTGGAGCATGGGCTATGGTGAGGCCTTCC GATGCTATACCTGTGAGCAGCCCACGGCCATTAACTCATGCAAGAATATTGCTCAGTGCAAGATGGAAGA CACAGCCTGTAAGACTGTACTGGAGACAGTGGAAGCAGCGTTCCCCTTCAACCACAGTCCCATGGTGACC CGCTCCTGCTCCAGCTCGTGTCTGGCCACCGACCCTGATGGCATTGGCGTTGCCCATCCTGTCTTCTGTT GCTTCCGTGACCTCTGCAACTCAGGGTTTCCAGGCTTCGTGGCAGGCCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_020519 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020519.1, NP_065265.1 |
RefSeq Size | 525 bp |
RefSeq ORF | 333 bp |
Locus ID | 57277 |
UniProt ID | Q9Z0K7 |
Gene Summary | Has an antitumor activity. Was found to be a marker of late differentiation of the skin. Implicated in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. In vitro down-regulates keratinocyte proliferation; the function may involve the proposed role as modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro inhibits alpha-7-dependent nAChR currents in an allosteric manner (By similarity). In T cells may be involved in regulation of intracellular Ca(2+) signaling (PubMed:17286989). Seems to have a immunomodulatory function in the cornea. The function may implicate a possible role as a scavenger receptor for PLAU thereby blocking PLAU-dependent functions of PLAUR such as in cell migration and proliferation (PubMed:23139280, PubMed:25168896).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226243 | Slurp1 (tGFP-tagged) - Mouse secreted Ly6/Plaur domain containing 1 (Slurp1), (10ug) |
CNY 2,850.00 |
|
MR226243 | Slurp1 (Myc-DDK-tagged) - Mouse secreted Ly6/Plaur domain containing 1 (Slurp1) |
CNY 1,200.00 |
|
MR226243L3 | Lenti ORF clone of Slurp1 (Myc-DDK-tagged) - Mouse secreted Ly6/Plaur domain containing 1 (Slurp1) |
CNY 4,750.00 |
|
MR226243L4 | Lenti ORF clone of Slurp1 (mGFP-tagged) - Mouse secreted Ly6/Plaur domain containing 1 (Slurp1) |
CNY 4,750.00 |