Scgb3a1 (NM_170727) Mouse Untagged Clone
CAT#: MC210769
Scgb3a1 (untagged) - Mouse secretoglobin, family 3A, member 1 (Scgb3a1), transcript variant B, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | HIN; HIN-1; LuLe; LuLeu2; Pnsp2; UGR; UGRP2; Utgrp2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210769 representing NM_170727
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCCACAATCAGCAAGGCACAGTGTTGCTTTCTTCATGGACTCATTGGCCAAGCCTGCGGTAGAAC CCGTGGCCGCCCTTGCTCCAGCTGCAGAGGCTGTGGCAGGGGCTGTGCCTAGCCTACCATTAAGCCACTT GGCCATCCTGAGGTTCATCCTGGCCAGCATGGGCATCCCATTGGATCCTCTCATAGAGGGATCCAGGAAG TGTGTCACCGAGCTGGGCCCTGAGGCTGTAGGAGCTGTGAAGTCACTGCTGGGGGTCCTGACAATGTTCG GTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_170727 |
Insert Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_170727.2, NP_733923.1 |
RefSeq Size | 645 bp |
RefSeq ORF | 285 bp |
Locus ID | 68662 |
Gene Summary | This gene encodes a small secreted protein that may function in the inhibition of cell growth. Expression of the related gene in humans is downregulated via DNA methylation in breast cancers and other tumor types. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (2, also known as type B) differs in the 5' UTR and contains an alternate exon in the 5' coding region, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (b) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223117 | Scgb3a1 (tGFP-tagged) - Mouse secretoglobin family 3A member 1 (Scgb3a1) transcript variant B, (10ug) |
CNY 2,090.00 |
|
MR223117 | Scgb3a1 (Myc-DDK-tagged) - Mouse secretoglobin, family 3A, member 1 (Scgb3a1), transcript variant B |
CNY 1,900.00 |
|
MR223117L3 | Lenti ORF clone of Scgb3a1 (Myc-DDK-tagged) - Mouse secretoglobin, family 3A, member 1 (Scgb3a1), transcript variant B |
CNY 3,800.00 |
|
MR223117L4 | Lenti ORF clone of Scgb3a1 (mGFP-tagged) - Mouse secretoglobin, family 3A, member 1 (Scgb3a1), transcript variant B |
CNY 3,800.00 |
其它Scgb3a1产品