Cnot2 (NM_001037848) Mouse Untagged Clone
CAT#: MC211284
Cnot2 (untagged) - Mouse CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 4, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2600016M12Rik; 2810470K03Rik; AA537049; AA959607; AW557563; C79650 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211284 representing NM_001037848
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAGGACTGATGGACATACATTATCTGAGAAAAGAAACTACCAGGTGACAAACAGCATGTTTGGTG CTTCAAGAAAGAAGTTTGTAGAGGGGGTGGACAGCGACTACCATGATGAGAACATGTACTACAGCCAGTC TTCTATGTTCCCACATCGGTCAGAGAAAGATATGCTGGCATCGCCATCTACGTCAGGTCAGCTGTCTCAA TTTGGGGCAAGTTTATACGGGCAACAAAGATTTCTGAAAAGAGGATCCATGAAGAATTTAATTCATTACT CAGCATCATGTCAAAAAGAGATAGGAATCTATTTAGAATACGTACATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037848 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037848.3, NP_001032937.1 |
RefSeq Size | 1059 bp |
RefSeq ORF | 330 bp |
Locus ID | 72068 |
UniProt ID | Q8C5L3 |
Gene Summary | Component of the CCR4-NOT complex which is one of the major cellular mRNA deadenylases and is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. Additional complex functions may be a consequence of its influence on mRNA expression. Required for the CCR4-NOT complex structural integrity. Can repress transcription and may link the CCR4-NOT complex to transcriptional regulation; the repressive function may specifically involve the N-Cor repressor complex containing HDAC3, NCOR1 and NCOR2. Involved in the maintenance of embryonic stem (ES) cell identity; prevents their differentiation towards extraembryonic trophectoderm lineages.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 3' UTR, lacks several exons in the 3' coding region, and includes an alternate terminal exon, compared to variant 1. The resulting isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224117 | Cnot2 (tGFP-tagged) - Mouse CCR4-NOT transcription complex subunit 2 (Cnot2) transcript variant 4, (10ug) |
CNY 2,090.00 |
|
MR224117 | Cnot2 (Myc-DDK-tagged) - Mouse CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 4 |
CNY 1,900.00 |
|
MR224117L3 | Lenti ORF clone of Cnot2 (Myc-DDK-tagged) - Mouse CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 4 |
CNY 3,800.00 |
|
MR224117L4 | Lenti ORF clone of Cnot2 (mGFP-tagged) - Mouse CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant 4 |
CNY 3,800.00 |