Kcnip2 (NM_145704) Mouse Untagged Clone

CAT#: MC211935

Kcnip2 (untagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant c, (10ug)



  "NM_145704" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms KChI; KChIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211935 representing NM_145704
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGGGCCAAGGCCGAAAGGAGAGTTTGTCCGAATCCCGAGATTTGGACGGCTCCTATGACCAGCTTA
CGGACAGCGTGGAGGATGAGTTTGAACTATCCACGGTGTGCCACCGGCCTGAGGGTCTGGAACAACTCCA
GGAACAAACCAAGTTCACACGCAGAGAGTTGCAGGTCCTGTACAGAGGCTTCAAGAACGAATGTCCCAGC
GGAATTGTCAACGAGGAGAACTTCAAGCAAATTTATTCTCAGTTCTTTCCCCAAGGAGACTCCAGCAACT
ACGCTACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCTGTCAGTTTTGAGGACTTTGTGGC
TGGTTTGTCAGTGATTCTTCGGGGAACCATAGATGATAGACTGAACTGGGCTTTCAACTTATATGACCTC
AACAAGGATGGCTGTATCACGAAGGAGGAAATGCTCGACATCATGAAGTCCATCTATGACATGATGGGCA
AGTACACCTACCCTGCCCTCCGGGAGGAGGCCCCGAGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGA
CAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAACAGGACGAGAACATCATG
AGGTCCATGCAACTCTTTGATAATGTCATCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145704
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145704.2, NP_663750.1
RefSeq Size 2264 bp
RefSeq ORF 663 bp
Locus ID 80906
UniProt ID Q9JJ69
Gene Summary This gene encodes a member of the voltage-gated potassium channel-interacting protein (KCNIP) family. KCNIP family members are small calcium binding proteins that commonly exhibit unique variation at their N-termini, and which modulate A-type potassium channels. This gene is predominantly expressed in the adult heart, and to a lesser extent in the brain. Disruption of this gene is associated with susceptibility to cardiac arrhythmias and lack of transient outward potassium current in ventricular myocytes, and downregulated expression is associated with cardiac hypertrophy. The encoded protein has also been implicated as a repressor of immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (c) lacks two consecutive internal exons in the coding region but maintains the reading frame, compared to variant a. The encoded isoform (c, also known as KCHIP2S) is shorter, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...