Lin28b (NM_001031772) Mouse Untagged Clone
CAT#: MC214667
Lin28b (untagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b), (10ug)
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810403D23Rik; D030047M17Rik; Lin-28.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214667 representing NM_001031772
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAAGGCGGGGCAAGCAAAGGTGAAGAGCCAGAAAAACTGCCCGGGCTGGCAGAGGACGAACCCC AGGTTCTGCATGGCACTGGCCACTGTAAATGGTTCAACGTGCGCATGGGATTCGGATTCATCTCCATGAT AAGTCGAGAGGGAAATCCCTTGGATATTCCAGTGGATGTATTTGTACACCAAAGCAAACTATTCATGGAA GGATTTAGAAGCTTGAAAGAAGGAGAGCCAGTGGAATTTACATTTAAAAAATCCCCCAAAGGCCTTGAGT CAATACGGGTAACAGGCCCAGGTGGGAGCCCCTGCTTAGGAAGTGAAAGAAGACCTAAAGGGAAGACCCT GCAAAAGAGAAAGCCAAAGGGAGATAGGTGGAGACGGCAGGATTTACTGATGGATCAGATGTGGACTGTG CGAGAAGAAGAGTCCAGGATGATTCCAAGATGCTACAACTGTGGTGGTCTCGACCATCATGCTAAAGAAT GCAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATGGTGGCCAACTGCCC ACACAAGCTTGCCGCTCAGCTGCCCGCCAGTTCTCAGGGAAGACAGGAGGCAGAATCCCAGCCATGCAGC TCTGCGGCACCAAGAGAAGTGGGAGGGGGGCATGGCTGCACAGTACTGTTTCCTCAGGAGGTGAAGTCAG AAATGGCAGAGCACTCAGACAGGTCACCCCAAGAAGTTTCTTCCACGAAAGCGTTTGCAGCAATAGGAGA GCAAAACAAAAAGGGGCCTTTGATTCAGAAACGGAAAAAGACTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001031772 |
Insert Size | 816 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC089037, AAH89037 |
RefSeq Size | 5411 bp |
RefSeq ORF | 816 bp |
Locus ID | 380669 |
UniProt ID | Q45KJ6 |
Gene Summary | Suppressor of microRNA (miRNA) biogenesis, including that of let-7 and possibly of miR107, miR-143 and miR-200c. Binds primary let-7 transcripts (pri-let-7), including pri-let-7g and pri-let-7a-1, and sequester them in the nucleolus, away from the microprocessor complex, hence preventing their processing into mature miRNA. Does not act on pri-miR21. The repression of let-7 expression is required for normal development and contributes to maintain the pluripotent state of embryonic stem cells by preventing let-7-mediated differentiation. When overexpressed, recruits ZCCHC11/TUT4 uridylyltransferase to pre-let-7 transcripts, leading to their terminal uridylation and degradation. This activity might not be relevant in vivo, as LIN28B-mediated inhibition of let-7 miRNA maturation appears to be ZCCHC11-independent. Interaction with target pre-miRNAs occurs via an 5'-GGAG-3' motif in the pre-miRNA terminal loop (By similarity). Mediates MYC-induced let-7 repression (PubMed:19211792). When overexpressed, may stimulate growth of carcinoma cell lines (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
LIN28B promotes the progression of colon cancer by increasing B-cell lymphoma 2 expression
,Yuan, L;Tian, J;,
Biomed. Pharmacother.
,PubMed ID 29669301
[LIN28B]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225677 | Lin28b (tGFP-tagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b), (10ug) |
CNY 4,000.00 |
|
MR225677 | Lin28b (Myc-DDK-tagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b) |
CNY 2,400.00 |
|
MR225677L3 | Lenti ORF clone of Lin28b (Myc-DDK-tagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b) |
CNY 4,800.00 |
|
MR225677L4 | Lenti ORF clone of Lin28b (mGFP-tagged) - Mouse lin-28 homolog B (C. elegans) (Lin28b) |
CNY 4,800.00 |