Brsk1 (NM_001168572) Mouse Untagged Clone

CAT#: MC214742

Brsk1 (untagged) - Mouse BR serine/threonine kinase 1 (Brsk1), transcript variant 2, (10ug)



  "NM_001168572" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Brsk1 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gm1100; SAD-B; SADB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214742 representing NM_001168572
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTCCGGGTCCAAGGAAGGTGGCGGGGGCTCCCCCGCCTACCACCTCCCACACCCACACCCACACC
CACCCCAGCACGCCCAATATGTGGGCCCCTATCGCCTGGAGAAGACGCTGGGCAAAGGACAGACAGGTCT
AGTTAAACTTGGAGTCCACTGCATCACGGGTCAGAAGGTCGCTGTCAAGATCGTGAACAGGGAGAAGCTG
TCGGAATCGGTGCTGATGAAGGTGGAGAGGGAAATCGCCATCCTGAAGCTCATTGAACACCCGCACGTGC
TCAAGCTCCACGACGTCTACGAGAACAAGAAATATTTATACTTGGTTCTTGAGCACGTTTCTGGTGGTGA
GCTGTTCGACTACCTGGTAAAAAAAGGGAGACTGACACCCAAGGAGGCCCGGAAGTTCTTCCGCCAGATC
GTGTCAGCACTGGACTTCTGCCATAGCTACTCCATCTGTCACAGAGACTTGAAGCCAGAGAACCTGCTGT
TGGATGAGAAAAACAACATCCGCATCGCAGACTTTGGTATGGCGTCCCTGCAAGTGGGGGACAGCCTCCT
GGAGACCAGCTGCGGGTCCCCCCATTACGCATGTCCAGAGGTGATCAAGGGGGAAAAGTATGATGGCCGC
CGGGCAGACATGTGGAGCTGTGGAGTCATCCTATTTGCCCTGCTTGTGGGGGCACTGCCCTTCGATGACG
ACAACCTGCGCCAGCTACTGGAGAAGGTGAAACGTGGGGTCTTCCACATGCCTCACTTCATCCCTCCAGA
CTGCCAGAGCCTCCTGAGAGGGATGATTGAAGTGGAGCCCGAGAAAAGGCTCAGTCTGGAGCAAATTCAG
AAACATCCTTGGTATCTGGGCGGGAAACACGAACCAGACCCTTGCCTGGAGCCAGCCCCAGGCCGCAGAG
TAGCCATGCGTAGCCTGCCTTCCAATGGCGAGCTGGACCCTGACGTTCTGGAAAGCATGGCGTCTCTGGG
CTGCTTCAGAGACCGCGAGCGGCTGCACAGAGAACTGCGAAGCGAGGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001168572
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001168572.1, NP_001162044.1
RefSeq Size 1391 bp
RefSeq ORF 1032 bp
Locus ID 381979
UniProt ID Q5RJI5
Gene Summary Serine/threonine-protein kinase that plays a key role in polarization of neurons and centrosome duplication. Phosphorylates CDC25B, CDC25C, MAPT/TAU, RIMS1, TUBG1, TUBG2 and WEE1. Following phosphorylation and activation by STK11/LKB1, acts as a key regulator of polarization of cortical neurons, probably by mediating phosphorylation of microtubule-associated proteins such as MAPT/TAU at 'Thr-504' and 'Ser-554'. Also regulates neuron polarization by mediating phosphorylation of WEE1 at 'Ser-642' in post-mitotic neurons, leading to down-regulate WEE1 activity in polarized neurons. In neurons, localizes to synaptic vesicles and plays a role in neurotransmitter release, possibly by phosphorylating RIMS1. Also acts as a positive regulator of centrosome duplication by mediating phosphorylation of gamma-tubulin (TUBG1 and TUBG2) at 'Ser-131', leading to translocation of gamma-tubulin and its associated proteins to the centrosome. Involved in the UV-induced DNA damage checkpoint response, probably by inhibiting CDK1 activity through phosphorylation and activation of WEE1, and inhibition of CDC25B and CDC25C.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...