United States
Germany
Japan
United Kingdom
China
H2bc23 (NM_001097979) Mouse Untagged Clone
CAT＃: MC215366
Hist1h2bq (untagged) - Mouse histone cluster 1, H2bq (Hist1h2bq), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gm13646; Hist1h2; Hist1h2bq |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC215366 representing NM_001097979
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTGAGCCTGCGAAGTCCGCTCCCGCCCCGAAGAAGGGCTCCAAGAAGGCCGTCACCAAGGCCCAGA AGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCGGTGTACGTGTACAAGGTGCTGAA GCAAGTGCACCCCGACACCGGCATCTCCTCCAAGGCCATGGGCATCATGAACTCGTTCGTGAACGACATC TTCGAGCGCATCGCGAGCGAGGCGTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACGTCCCGGG AGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGCTGGCCAAGCACGCGGTGTCGGAGGGCACCAA GGCCGTCACCAAGTACACCAGCTCCAATTTTTCAAGACAAAATTTCTCTGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001097979 |
| Insert Size | 405 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001097979.2, NP_001091448.2 |
| RefSeq Size | 2121 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 665596 |
| Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## replication-dependent histone :: PMID: 12408966 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG224652 | Hist1h2bq (tGFP-tagged) - Mouse predicted gene 13646 (Gm13646), (10ug) |
CNY 2,850.00 |
|
| MR224652 | Hist1h2bq (Myc-DDK-tagged) - Mouse histone cluster 1, H2bq (Hist1h2bq) |
CNY 1,200.00 |
|
| MR224652L3 | Lenti ORF clone of Hist1h2bq (Myc-DDK-tagged) - Mouse histone cluster 1, H2bq (Hist1h2bq) |
CNY 4,750.00 |
|
| MR224652L4 | Lenti ORF clone of Hist1h2bq (mGFP-tagged) - Mouse histone cluster 1, H2bq (Hist1h2bq) |
CNY 4,750.00 |
