Tfeb (NM_001161722) Mouse Untagged Clone

CAT#: MC216481

Tfeb (untagged) - Mouse transcription factor EB (Tcfeb), transcript variant 2, (10ug)



  "NM_001161722" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Goat Polyclonal Antibody against TFEB
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms bHLHe35; Tcfeb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216481 representing NM_001161722
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCACGCATCGGGCTGCGCATGCAGCTCATGCGGGAGCAGGCCCAGCAGGAGGAGCAGCGAGAGC
GCATGCAGCAGCAGGCTGTCATGCATTATATGCAACAGCAGCAGCAGCAGCAGCAGCAGCTGGGTGGGCC
CCCCACCCCAGCCATCAACACCCCTGTCCACTTCCAGTCGCCCCCGCCTGTGCCCGGGGAGGTGCTGAAG
GTGCAGTCCTACCTGGAGAACCCCACCTCCTACCACCTGCAACAGTCCCAGCATCAGAAGGTTCGGGAGT
ATCTGTCTGAGACCTATGGGAACAAGTTTGCTGCCCACGTGAGCCCAGCCCAAGGTTCCCCGAAGCCTGC
CCCAGCAGCATCCCCAGGGGTGCGGGCTGGACACGTACTGTCCACCTCGGCCGGCAACAGTGCTCCCAAC
AGTCCCATGGCCATGCTACATATCAGCTCCAACCCCGAGAAAGAGTTTGATGATGTCATTGACAACATTA
TGCGCCTGGACAGCGTGCTGGGCTACATCAACCCTGAGATGCAGATGCCTAACACGCTGCCCCTGTCTAG
CAGCCACCTGAACGTGTACAGCGGTGACCCCCAGGTCACAGCCTCCATGGTGGGTGTCACCAGCAGCTCC
TGCCCTGCCGACCTGACTCAGAAGCGAGAGCTAACAGATGCTGAGAGCAGAGCCCTGGCCAAGGAGCGGC
AGAAGAAAGACAATCACAACCTAATTGAGAGAAGACGCAGGTTCAACATCAATGACCGGATCAAGGAGCT
GGGAATGCTGATCCCCAAGGCCAACGACCTGGACGTGCGCTGGAACAAAGGCACCATCCTCAAGGCCTCT
GTGGATTACATCCGGAGGATGCAGAAGGACCTGCAGAAGTCCCGGGAGCTGGAGAACCACTCCCGGCGCC
TGGAGATGACTAACAAGCAGCTCTGGCTCCGCATCCAGGAGCTGGAGATGCAGGCACGCGTGCACGGCCT
CCCCACCACCTCGCCGTCGGGTGTGAATATGGCCGAGCTGGCCCAGCAGGTGGTGAAGCAAGAGTTGCCC
AGTGAGGATGGCCCAGGGGAGGCGCTGATGCTGGGGCCTGAGGTCCCTGAGCCTGAGCAAATGCCGGCTC
TTCCTCCCCAGGCTCCGCTGCCCTCGGCCGCCCAGCCACAGTCTCCGTTCCATCACCTGGACTTCAGCCA
TGGCCTGAGCTTTGGGGGTGGGGGCGACGAGGGGCCCACAGGTTACCCCGATACCCTGGGGACAGAGCAC
GGCTCCCCATTCCCCAACCTGTCCAAGAAGGATCTGGACTTAATGCTCCTAGATGACTCCCTGCTCCCCC
TGGCCTCTGACCCCCTCTTTTCTACCATGTCTCCTGAGGCCTCCAAGGCCAGCAGCCGCCGGAGCAGCTT
CAGCATGGAGGAGGGTGATGTTCTGTGAACGCGT


ACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGA
TTACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-RsrII     
ACCN NM_001161722
Insert Size 1434 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001161722.1, NP_001155194.1
RefSeq Size 2357 bp
RefSeq ORF 1428 bp
Locus ID 21425
UniProt ID Q9R210
Gene Summary Transcription factor that specifically recognizes and binds E-box sequences (5'-CANNTG-3'). Efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression. It thereby plays a central role in expression of lysosomal genes. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1 (PubMed:29146937).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...