Timp1 (NM_001044384) Mouse Untagged Clone

CAT#: MC226288

Timp1 (untagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 1



  "NM_001044384" in other vectors (1)

CNY 2,090.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Clgi; EPA; Timp; TIMP-1; TPA-S1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226288 representing NM_001044384
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGCCCCCTTTGCATCTCTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGG
CCTGTAGCTGTGCCCCACCCCACCCACAGACAGCCTTCTGCAACTCGGACCTGGTCATAAGGGCTAAATT
CATGGGTTCCCCAGAAATCAACGAGACCACCTTATACCAGCGTTATAAGATCAAGATGACTAAGATGCTA
AAAGGATTCAAGGCTGTGGGAAATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAAGCCTCT
GTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAACGGAAA
TTTGCACATCAGTGCCTGCAGCTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGAGCTTTC
TCAAAGACCTATAGTGCTGGCTGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCAAACTGG
AGAGTGACACTCACTGTTTGTGGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCGTCACTT
TGCTTGCCTGCCACGGAATCCAGGCTTGTGCACCTGGAGATCCCTTGGGGCCCGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001044384
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001044384.1, NP_001037849.1
RefSeq Size 905 bp
RefSeq ORF 618 bp
Locus ID 21857
UniProt ID P12032
Gene Summary Metalloproteinase inhibitor that functions by forming one to one complexes with target metalloproteinases, such as collagenases, and irreversibly inactivates them by binding to their catalytic zinc cofactor. Acts on MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, MMP10, MMP11, MMP12, MMP13 and MMP16. Does not act on MMP14 (By similarity). Also functions as a growth factor that regulates cell differentiation, migration and cell death and activates cellular signaling cascades via CD63 and ITGB1. Plays a role in integrin signaling.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...