Prkcg (NM_001291434) Mouse Untagged Clone

CAT#: MC228569

Prkcg (untagged) - Mouse protein kinase C, gamma (Prkcg), transcript variant 2



  "NM_001291434" in other vectors (1)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Pkcc; PKCgamma; Prkcc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228569 representing NM_001291434
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGTCTGGGCCCTGGCGGAGGCGACTCAGAGGGGGGACCCCGACCCCTGTTTTGCAGAAAGGGGG
CGCTGAGGCAGAAGGTGGTCCACGAGGTGAAGAGCCACAAGTTCACCGCTCGTTTCTTCAAGCAGCCAAC
CTTCTGCAGTCACTGTACCGACTTCATCTGGGGCATTGGAAAGCAGGGCCTGCAATGTCAAGTCTGTAGC
TTTGTGGTTCACCGCCGATGCCACGAATTTGTGACCTTCGAGTGTCCAGGCGCTGGAAAGGGCCCCCAGA
CGGACGACCCTCGCAACAAGCACAAGTTCCGTCTGCACAGCTACAGCAGTCCCACCTTCTGCGACCACTG
TGGCTCCCTCCTTTACGGGCTGGTGCACCAGGGCATGAAATGTTCCTGTTGCGAGATGAATGTGCACCGG
CGCTGTGTGCGCAGCGTGCCCTCCCTTTGCGGTGTGGACCACACAGAGCGCCGTGGACGTCTGCAACTGG
AAATCCGGGCTCCTACGTCGGATGAGATCCATATTACTGTTGGCGAGGCCCGGAACCTCATTCCTATGGA
CCCCAATGGCCTGTCTGATCCCTACGTGAAACTGAAGCTGATCCCGGACCCTCGGAACCTGACAAAACAG
AAGACAAAGACCGTGAAAGCCACACTGAATCCCGTGTGGAACGAGACCTTCGTGTTCAACCTGAAGCCAG
GGGATGTAGAGCGCCGGCTCAGTGTGGAGGTGTGGGATTGGGATAGGACATCCCGAAATGACTTCATGGG
TGCCATGTCCTTTGGTGTCTCAGAGCTACTCAAGGCCCCTGTGGATGGATGGTACAAGTTACTGAACCAG
GAGGAGGGCGAATATTACAATGTACCGGTGGCCGATGCTGACAACTGCAGCCTCCTCCAGAAGTTTGAGG
CCTGCAATTACCCCTTGGAATTGTATGAGGTAATGCTGGCAGAGCGCAGAGGCTCCGACGAACTCTATGC
CATCAAGATACTGAAGAAAGACGTCATCGTCCAGGATGACGATGTAGACTGCACCCTCGTAGAGAAGCGT
GTCCTGGCATTGGGAGGCCGAGGTCCTGGAGGCCGGCCACACTTTCTCACGCAGCTTCACTCCACCTTTC
AGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCA
ACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTT
CACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCA
AGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCAC
CCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTT
GGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTC
AAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGG
GTTCCTGACCAAGCACCCAGGAAAACGCCTGGGCTCAGGGCCAGATGGGGAACCCACCATCCGGGCTCAT
GGCTTTTTCCGTTGGATCGATTGGGAGAGGTTGGAGAGACTGGAAATTGCACCTCCTTTCAGACCACGTC
CGTGTGGCCGCAGTGGCGAAAACTTTGACAAGTTCTTCACGCGGGCAGCGCCAGCACTGACCCCGCCAGA
CCGCTTGGTTCTAGCCAGCATCGACCAAGCTGATTTCCAGGGCTTTACTTATGTGAACCCGGACTTCGTG
CACCCAGATGCCCGCAGCCCCACAAGCCCTGTGCCCGTGCCTGTCATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291434
Insert Size 1941 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291434.1, NP_001278363.1
RefSeq Size 2978 bp
RefSeq ORF 1941 bp
Locus ID 18752
Gene Summary Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that plays diverse roles in neuronal cells and eye tissues, such as regulation of the neuronal receptors GRIA4/GLUR4 and GRIN1/NMDAR1, modulation of receptors and neuronal functions related to sensitivity to opiates, pain and alcohol, mediation of synaptic function and cell survival after ischemia, and inhibition of gap junction activity after oxidative stress. Binds and phosphorylates GRIA4/GLUR4 glutamate receptor and regulates its function by increasing plasma membrane-associated GRIA4 expression. In primary cerebellar neurons treated with the agonist 3,5-dihyidroxyphenylglycine, functions downstream of the metabotropic glutamate receptor GRM5/MGLUR5 and phosphorylates GRIN1/NMDAR1 receptor which plays a key role in synaptic plasticity, synaptogenesis, excitotoxicity, memory acquisition and learning. May be involved in the regulation of hippocampal long-term potentiation (LTP), but may be not necessary for the process of synaptic plasticity. May be involved in desensitization of mu-type opioid receptor-mediated G-protein activation in the spinal cord, and may be critical for the development and/or maintenance of morphine-induced reinforcing effects in the limbic forebrain. May modulate the functionality of mu-type-opioid receptors by participating in a signaling pathway which leads to the phosphorylation and degradation of opioid receptors. May also contribute to chronic morphine-induced changes in nociceptive processing. Plays a role in neuropathic pain mechanisms and contributes to the maintenance of the allodynia pain produced by peripheral inflammation. Plays an important role in initial sensitivity and tolerance to ethanol, by mediating the behavioral effects of ethanol as well as the effects of this drug on the GABA(A) receptors. During and after cerebral ischemia modulate neurotransmission and cell survival in synaptic membranes, and is involved in insulin-induced inhibition of necrosis, an important mechanism for minimizing ischemic injury. Required for the elimination of multiple climbing fibers during innervation of Purkinje cells in developing cerebellum. Is activated in lens epithelial cells upon hydrogen peroxide treatment, and phosphorylates connexin-43 (GJA1/CX43), resulting in disassembly of GJA1 gap junction plaques and inhibition of gap junction activity which could provide a protective effect against oxidative stress. Phosphorylates p53/TP53 and promotes p53/TP53-dependent apoptosis in response to DNA damage. Involved in the phase resetting of the cerebral cortex circadian clock during temporally restricted feeding. Stabilizes the core clock component ARNTL/BMAL1 by interfering with its ubiquitination, thus suppressing its degradation, resulting in phase resetting of the cerebral cortex clock (PubMed:23185022).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...