Ell3 (NM_001011957) Rat Untagged Clone

CAT#: RN201966

Ell3 (untagged ORF) - Rat elongation factor RNA polymerase II-like 3 (Ell3), (10 ug)



  "NM_001011957" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN201966 representing NM_001011957
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGGGACCCAGGAAGCTCTGAGTGGGAAAATGCGGCTCCTCTTCACCCCTGCTGCTCGAACCAGCC
TCCTGATGCTAAGACTCAACGAGGCGGCGCTGCGGGCACTACAAGAGTGTCAGCAGCAACAGGTACGGCC
AGTGATCGCTTTCCAAGGCCAACGAGGGTATCTAAGGCTCCCAGGTCCTGGATGGTCCTGCCTCTTCTCC
TTCATAGTATCCCAGTGTGGCCAAGAGGGTGGTGGCTTGGACCTTGTGTACCAACGCTTAGGCAGATCTG
GGCCTAACTGTCTCCACTGCCTGGGCTCACTGAGAGAGCGACTTACTATTTGGGCAGCCATGGATACGAT
CCCAGCTCCACTGTTAGCTCAGGAACACCTGACTGAAGGTACCAGAGAGTCTGAGAGCTGGCAGGACAGC
GAAGATGAACCTGAAGGCCATCCCCAGATGGCACTACAAGAGGTGTCTGACCCACTGGCAAGCAACCATG
AACAGTCACTCCCAGGATCCTCCAGTGAGCCCATGGCACAGTGGGAAGTGAGAAACCACACTTACCTTTC
AAACAGAGAGCCTGATCAGCCACTGCCTTCCTCTGCTAGCCAGAAACGCCTGGACAAGAAACGTTCAGCA
CCTATAACCACTGAAGAACCAGAGGAAAAAAGGCCCAGAGCTCTGCCTCTAGCCTCAAGTCCACTACAAG
GACTATCAAATCAGGACTCACCAGAGGAACAAGACTGGGGGCAAGATGCAGATGGAGATTCCAGGCTGGA
GCAGAGTCTCTCAGTTCAATCAGCTTCTGAATCCCCAAGCCCTGAGGAGGTACCAGATTATCTCCTGCAA
TACAGCACCATCCACAGTGCAGAGCAGCAGCAGGCCTACGAGCAGGACTTTGAGACCGACTATGCTGAAT
ACCGCATTCTGCACGCCCGTGTCGGGGCTGCAAGCCAGAGGTTCACAGAGCTGGGGGCAGAGATCAAGAG
ACTTCAGCGAGGAACTCCAGAGCACAAGGTGCTAGAAGACAAGATAGTCCAGGAGTATAAAAAGTTCAGA
AAGCGGTATCCCAGTTACAGCGAGGAGAAGCGGCGCTGTGAGTACCTGCATGAGAAACTGTCCCACATTA
AAGGTCTCATCCTGGAATTTGAGGAAAAGAACAGGGGCAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001011957
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011957.1, NP_001011957.1
RefSeq Size 1660 bp
RefSeq ORF 1164 bp
Locus ID 296102
UniProt ID Q5XFX8
Gene Summary Enhancer-binding elongation factor that specifically binds enhancers in embryonic stem cells (ES cells), marks them, and is required for their future activation during stem cell specification. Elongation factor component of the super elongation complex (SEC), a complex required to increase the catalytic rate of RNA polymerase II transcription by suppressing transient pausing by the polymerase at multiple sites along the DNA. Component of the little elongation complex (LEC), a complex required to regulate small nuclear RNA (snRNA) gene transcription by RNA polymerase II and III. Does not only bind to enhancer regions of active genes, but also marks the enhancers that are in a poised or inactive state in ES cells and is required for establishing proper RNA polymerase II occupancy at developmentally regulated genes in a cohesin-dependent manner. Probably required for priming developmentally regulated genes for later recruitment of the super elongation complex (SEC), for transcriptional activation during differentiation. Required for recruitment of P-TEFb within SEC during differentiation. Probably preloaded on germ cell chromatin, suggesting that it may prime gene activation by marking enhancers as early as in the germ cells. Promoting epithelial-mesenchymal transition (EMT) (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...