Cebpa (NM_012524) Rat Untagged Clone

CAT#: RN203689

Cebpa (untagged ORF) - Rat CCAAT/enhancer binding protein (C/EBP), alpha (Cebpa), (10 ug)



  "NM_012524" in other vectors (3)

CNY 3,990.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms DBPCEP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203689 representing NM_012524
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCGGCCGACTTCTACGAGGCGGAGCCGCGGCCCCCGATGAGCAGCCACCTCCAGAGCCCCCCGC
ACGCGCCCAGCAACGCCGCCTTTGGCTTTCCCCGGGGCGCGGGCCCCGCGCCGCCCCCAGCCCCACCTGC
CGCCCCGGAGCCGCTGGGCGGCATCTGCGAGCACGAGACGTCTATAGACATCAGCGCCTACATCGACCCG
GCCGCCTTCAACGACGAGTTCCTGGCCGACCTCTTCCAGCACAGCCGGCAGCAGGAGAAGGCCAAGGCGG
CGGCGGGCCCCGCGGGTGGCGGCGGTGACTTTGACTACCCGGGCGCCCCGGCGGGCCCCGGCGGTGCGGT
CATGTCCGCGGGGGCGCACGGACCCCCTCCCGGCTACGGCTGTGCGGCGGCCGGCTACCTGGACGGCAGG
CTGGAGCCCCTGTACGAGCGCGTCGGGGCGCCCGCGCTGCGGCCGCTGGTGATCAAGCAGGAGCCCCGCG
AGGAGGACGAGGCGAAGCAGCTGGCGCTGGCCGGCCTCTTCCCCTATCAGCCCCCGCCGCCGCCGCCGCC
ACCGCACCCGCACGCGTCTCCCGCGCACTTGGCCGCCCCTCACTTGCAGTTCCAGATCGCACACTGCGGC
CAGACCACCATGCACCTGCAGCCTGGCCACCCTACGCCGCCGCCGACGCCCGTGCCCAGCCCTCATCCCG
CGCCTGCAATGGGTGCTGCGGGCCTGCCGGGCCCCGGGGGCTCGCTCAAGGGCTTGGCTGGTCCGCACCC
CGACCTCCGCACCGGCGGCGGCGGCGGCGGCGGGGCCGGCGCGGGCAAGGCCAAGAAGTCGGTGGATAAG
AACAGCAACGAGTACCGGGTACGGCGGGAACGCAACAACATCGCGGTGCGCAAGAGCCGAGATAAAGCCA
AACAGCGCAACGTGGAGACGCAGCAGAAGGTGTTGGAGTTGACCAGTGACAATGACCGCCTGCGCAAGCG
GGTGGAACAGCTGAGCCGTGAACTGGACACGCTGCGGGGTATCTTCCGCCAGCTGCCTGAGAGCTCCTTG
GTCAAGGCCATGGGCAACTGCGCGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_012524
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012524.3, NP_036656.1
RefSeq Size 2673 bp
RefSeq ORF 1077 bp
Locus ID 24252
UniProt ID P05554
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. The use of alternative in-frame non-AUG (CUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the CUG and the first AUG start codons. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (1) can initiate translation from an upstream non-AUG (CUG) site, and also from three conserved downstream, in-frame AUG sites. The isoform (a) represented in this RefSeq results from translation initiation at the first AUG start codon. Isoform a has a shorter N-terminus, compared to isoform c. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...