Kcnmb3 (NM_001104560) Rat Untagged Clone

CAT#: RN203903

Kcnmb3 (untagged ORF) - Rat potassium large conductance calcium-activated channel, subfamily M beta member 3 (Kcnmb3), (10 ug)



  "NM_001104560" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Anti-sloBeta3 (KCNMB3) (extracellular)
    • 50 ul

CNY 11,000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN203903 representing NM_001104560
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCCCTTCAGCATCCCGGTCCAAATCACACTACAGGGTGGTCGGAGGCGCCAAGGGAGGACAGCAC
TTCCGGCCTCAGGCATAAGCAATGGAGATCCCCTGAAGGTGCACCCAAAACTTCCATCGAGCGCTGGTGA
GGACCGGGCCACGCTGCTGGGCATCGCCATGATGGCCTCCTCCGTGCTGATGTTCTTCCTGCTGGGGACC
ACTGTGTTGAAGCCCTTCATGCTCAGCTCTCCCAGAGAAGAATCAAACTGCACCACTGTCCACACACACA
TTGCAGATGATTGGCTGGACTTTGCCTTCACCTGTGAGGGTAGCTGCCAGGGCCAGGGGACATACCCTTG
CCTGCAGGTGTTCGTCAACCTTAGCCACTCGGGACAGAAAGTGCTTCTCCATTACGATGAGGAGGCCATC
AGGACCAACCCCAAGTGCTTTTACACACCCAAGTGTCACGGAGACAGGGATCATCTGCTCAACAGTGCCC
TGGACATCAAGGAATTCTTCGATCACAACAATGGAACTTTCCCCTGCTTCTACAGTCCTGACGGGCCCCT
GGGAGTGGTCCTGAGGAAGTCTGGCCACAAGGTTGTCTTTCACTGCTTATTTTGGCCTTTACTGACATTG
CTGGGAGGCGCTCTGATTGTTGGTTTGGTTAGGCTAACACAACATCTGTCCTTTCAGTGTGAAAAGTATA
GAGCAGTGGTAAGAGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001104560
Insert Size 720 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001104560.2, NP_001098030.1
RefSeq Size 1637 bp
RefSeq ORF 720 bp
Locus ID 310303
UniProt ID A7VL23
Gene Summary Regulatory subunit of the calcium activated potassium KCNMA1 (maxiK) channel. Modulates the calcium sensitivity and gating kinetics of KCNMA1, thereby contributing to KCNMA1 channel diversity. Alters the functional properties of the current expressed by the KCNMA1 channel. May partially inactivate the current of KCNBMA. Two or more subunits of KCNMB3 are required to block the KCNMA1 tetramer (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...