United States
Germany
Japan
United Kingdom
China
Sumo3 (NM_001024295) Rat Untagged Clone
CAT＃: RN208427
Sumo3 (untagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) (Sumo3), (10 ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Rat Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>RN208427 representing NM_001024295
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGAAGAGAAGCCCAAGGAGGGTGTGAAGACAGAGAACGACCACATCAACCTGAAAGTGGCAGGGC AGGATGGCTCAGTGGTGCAGTTCAAGATCAAGAGGCACACTCCGCTGAGCAAGCTGATGAAGGCCTACTG TGAGAGGCAGGGCTTGTCAATGAGGCAGATTCGATTCCGGTTTGATGGACAACCAATCAACGAAACAGAC ACTCCAGCCCAGCTGGAGATGGAGGATGAGGACACCATTGATGTATTCCAGCAGCAGACGGGAGGAACGG CCTCCCGAGCCAGCGTCCCCACACCCAGCCATTTTCCTGACATTTGCTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001024295 |
| Insert Size | 333 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001024295.1, NP_001019466.1 |
| RefSeq Size | 1596 bp |
| RefSeq ORF | 333 bp |
| Locus ID | 499417 |
| UniProt ID | Q5XIF4 |
| Gene Summary | Ubiquitin-like protein which can be covalently attached to target lysines either as a monomer or as a lysine-linked polymer. Does not seem to be involved in protein degradation and may function as an antagonist of ubiquitin in the degradation process. Plays a role in a number of cellular processes such as nuclear transport, DNA replication and repair, mitosis and signal transduction. Covalent attachment to its substrates requires prior activation by the E1 complex SAE1-SAE2 and linkage to the E2 enzyme UBE2I, and can be promoted by an E3 ligase such as PIAS1-4, RANBP2 or CBX4. Plays a role in the regulation of sumoylation status of SETX (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RR208427 | Sumo3 (Myc-DDK-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) (Sumo3), (10 ug) |
CNY 1,320.00 |
|
| RR208427L3 | Lenti ORF clone of Sumo3 (Myc-DDK-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) (Sumo3), (10 ug) |
CNY 6,080.00 |
|
| RR208427L4 | Lenti ORF clone of Sumo3 (mGFP-tagged ORF) - Rat SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae) (Sumo3), (10 ug) |
CNY 6,650.00 |
