United States
Germany
Japan
United Kingdom
China
TNFRSF4 (NM_003327) Human Untagged Clone
CAT＃: SC118037
TNFRSF4 (untagged)-Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4)
CNY 3,600.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACT35; CD134; IMD16; OX40; TXGP1L |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_003327 edited
CCGCAAGGAAAACCCAGACTCTGGCGACAGCAGAGACGAGGATGTGCGTGGGGGCTCGGC GGCTGGGCCGCGGGCCGTGTGCGGCTCTGCTCCTCCTGGGCCTGGGGCTGAGCACCGTGA CGGGGCTCCACTGTGTCGGGGACACCTACCCCAGCAACGACCGGTGCTGCCACGAGTGCA GGCCAGGCAACGGGATGGTGAGCCGCTGCAGCCGCTCCCAGAACACGGTGTGCCGTCCGT GCGGGCCGGGCTTCTACAACGACGTGGTCAGCTCCAAGCCGTGCAAGCCCTGCACGTGGT GTAACCTCAGAAGTGGGAGTGAGCGGAAGCAGCTGTGCACGGCCACACAGGACACAGTCT GCCGCTGCCGGGCGGGCACCCAGCCCCTGGACAGCTACAAGCCTGGAGTTGACTGTGCCC CCTGCCCTCCAGGGCACTTCTCCCCAGGCGACAACCAGGCCTGCAAGCCCTGGACCAACT GCACCTTGGCTGGGAAGCACACCCTGCAGCCGGCCAGCAATAGCTCGGACGCAATCTGTG AGGACAGGGACCCCCCAGCCACGCAGCCCCAGGAGACCCAGGGCCCCCCGGCCAGGCCCA TCACTGTCCAGCCCACTGAAGCCTGGCCCAGAACCTCACAGGGACCCTCCACCCGGCCCG TGGAGGTCCCCGGGGGCCGTGCGGTTGCCGCCATCCTGGGCCTGGGCCTGGTGCTGGGGC TGCTGGGCCCCCTGGCCATCCTGCTGGCCCTGTACCTGCTCCGGAGGGACCAGAGGCTGC CCCCCGATGCCCACAAGCCCCCTGGGGGAGGCAGTTTCCGGACCCCCATCCAAGAGGAGC AGGCCGACGCCCACTCCACCCTGGCCAAGATCTGACCTGGGCCCACCAAGGTGGACGCTG GGCCCCGCCAGGCTGGAGCCCGGAGGGTCTGCTGGGCGAGCAGGGCAGGTGCAGGCCGCC TGCCCCGCCACGCTCCTGGGCCAACTCTGCACCGTTCTAGGTGCCGATGGCTGCCTCCGG CTCTCTGCTTACGTATGCCATGCATACCTCCTGCCCCGCGGGACCACAATAAAAACCTTG GCAGACGGGA |
| Restriction Sites | Please inquire |
| ACCN | NM_003327 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003327.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003327.2, NP_003318.1 |
| RefSeq Size | 1084 bp |
| RefSeq ORF | 834 bp |
| Locus ID | 7293 |
| UniProt ID | P43489 |
| Domains | TNFR |
| Protein Families | Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor has been shown to activate NF-kappaB through its interaction with adaptor proteins TRAF2 and TRAF5. Knockout studies in mice suggested that this receptor promotes the expression of apoptosis inhibitors BCL2 and BCL2lL1/BCL2-XL, and thus suppresses apoptosis. The knockout studies also suggested the roles of this receptor in CD4+ T cell response, as well as in T cell-dependent B cell proliferation and differentiation. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood
,Minji Byun, Cindy S. Ma, Arzu Akçay, Vincent Pedergnana, Umaimainthan Palendira, Jinjong Myoung, Danielle T. Avery, Yifang Liu, Avinash Abhyankar, Lazaro Lorenzo, Monika Schmidt, Hye Kyung Lim, Olivier Cassar, Melanie Migaud, Flore Rozenberg, Nur Canpolat, Gönül Aydogan, Bernhard Fleckenstein, Jacinta Bustamante, Capucine Picard, Antoine Gessain, Emmanuelle Jouanguy, Ethel Cesarman, Martin Olivier, Philippe Gros, Laurent Abel, Michael Croft, Stuart G. Tangye, and Jean-Laurent Casanova,
J. Exp. Med., Aug 2013; 210: 1743 - 1759.
,PubMed ID 23897980
[TNFRSF4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211253 | TNFRSF4 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4) |
CNY 3,600.00 |
|
| RC211253L1 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC211253L2 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mGFP tagged |
CNY 6,000.00 |
|
| RC211253L3 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC211253L4 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mGFP tagged |
CNY 6,000.00 |
|
| RG211253 | TNFRSF4 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 4 (TNFRSF4) |
CNY 5,200.00 |
其它TNFRSF4产品
