Persephin (PSPN) (NM_004158) Human Untagged Clone
CAT#: SC303442
PSPN (untagged)-Human persephin (PSPN)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PSP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_004158 edited
ATGGCCGTAGGGAAGTTCCTGCTGGGCTCCCTGCTGCTCCTGTCCCTGCAGCTGGGACAG GGCTGGGGCCCCGATGCCCGTGGGGTTCCCGTGGCCGATGGAGAGTTCTCGTCTGAACAG GTGGCAAAGGCTGGAGGGACCTGGCTGGGCACCCACCGCCCCCTTGCCCGCCTGCGCCGA GCCCTGTCTGGTCCATGCCAGCTGTGGAGCCTGACCCTGTCCGTGGCAGAGCTAGGCCTG GGCTACGCCTCAGAGGAGAAGGTCATCTTCCGCTACTGCGCCGGCAGCTGCCCCCGTGGT GCCCGCACCCAGCATGGCCTGGCGCTGGCCCGGCTGCAGGGCCAGGGCCGAGCCCACGGC GGGCCCTGCTGCCGGCCCACTCGCTACACCGACGTGGCCTTCCTCGATGACCGCCACCGC TGGCAGCGGCTGCCCCAGCTCTCGGCGGCTGCCTGCGGCTGTGGTGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_004158 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004158.2, NP_004149.1 |
RefSeq Size | 471 bp |
RefSeq ORF | 471 bp |
Locus ID | 5623 |
UniProt ID | O60542 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a secreted ligand of the GDNF (glial cell line-derived neurotrophic factor) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. This protein may play a role in cell death, and nervous system development and function. Elevated expression of this gene has been observed in oral squamous cell carcinoma. [provided by RefSeq, Aug 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219067 | PSPN (Myc-DDK-tagged)-Human persephin (PSPN) |
CNY 1,800.00 |
|
RC219067L1 | Lenti ORF clone of Human persephin (PSPN), Myc-DDK-tagged |
CNY 4,200.00 |
|
RC219067L2 | Lenti ORF clone of Human persephin (PSPN), mGFP tagged |
CNY 5,890.00 |
|
RC219067L3 | Lenti ORF clone of Human persephin (PSPN), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219067L4 | Lenti ORF clone of Human persephin (PSPN), mGFP tagged |
CNY 5,890.00 |
|
RG219067 | PSPN (tGFP-tagged) - Human persephin (PSPN) |
CNY 3,400.00 |
其它Persephin产品