RUNX3 (NM_004350) Human Untagged Clone
CAT#: SC303470
RUNX3 (untagged)-Human runt-related transcription factor 3 (RUNX3), transcript variant 2
CNY 6,650.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AML2; CBFA3; PEBP2aC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_004350, the custom clone sequence may differ by one or more nucleotides
ATGCGTATTCCCGTAGACCCAAGCACCAGCCGCCGCTTCACACCTCCCTCCCCGGCCTTC CCCTGCGGCGGCGGCGGCGGCAAGATGGGCGAGAACAGCGGCGCGCTGAGCGCGCAGGCG GCCGTGGGGCCCGGAGGGCGCGCCCGGCCCGAGGTGCGCTCGATGGTGGACGTGCTGGCG GACCACGCAGGCGAGCTCGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCC TCGCACTGGCGCTGCAACAAGACGCTGCCCGTCGCCTTCAAGGTGGTGGCATTGGGGGAC GTGCCGGATGGTACGGTGGTGACTGTGATGGCAGGCAATGACGAGAACTACTCCGCTGAG CTGCGCAATGCCTCGGCCGTCATGAAGAACCAGGTGGCCAGGTTCAACGACCTTCGCTTC GTGGGCCGCAGTGGGCGAGGGAAGAGTTTCACCCTGACCATCACTGTGTTCACCAACCCC ACCCAAGTGGCGACCTACCACCGAGCCATCAAGGTGACCGTGGACGGACCCCGGGAGCCC AGACGGCACCGGCAGAAGCTGGAGGACCAGACCAAGCCGTTCCCTGACCGCTTTGGGGAC CTGGAACGGCTGCGCATGCGGGTGACACCGAGCACACCCAGCCCCCGAGGCTCACTCAGC ACCACAAGCCACTTCAGCAGCCAGCCCCAGACCCCAATCCAAGGCACCTCGGAACTGAAC CCATTCTCCGACCCCCGCCAGTTTGACCGCTCCTTCCCCACGCTGCCAACCCTCACGGAG AGCCGCTTCCCAGACCCCAGGATGCATTATCCCGGGGCCATGTCAGCTGCCTTCCCCTAC AGCGCCACGCCCTCGGGCACGAGCATCAGCAGCCTCAGCGTGGCGGGCATGCCGGCCACC AGCCGCTTCCACCATACCTACCTCCCGCCACCCTACCCGGGGGCCCCGCAGAACCAGAGC GGGCCCTTCCAGGCCAACCCGTCCCCCTACCACCTCTACTACGGGACATCCTCTGGCTCC TACCAGTTCTCCATGGTGGCCGGCAGCAGCAGTGGGGGCGACCGCTCACCTACCCGCATG CTGGCCTCTTGCACCAGCAGCGCTGCCTCTGTCGCCGCCGGCAACCTCATGAACCCCAGC CTGGGCGGCCAGAGTGATGGCGTGGAGGCCGACGGCAGCCACAGCAACTCACCCACGGCC CTGAGCACGCCAGGCCGCATGGATGAGGCCGTGTGGCGGCCCTACTGA |
Restriction Sites | Please inquire |
ACCN | NM_004350 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004350.1, NP_004341.1 |
RefSeq Size | 3809 bp |
RefSeq ORF | 1248 bp |
Locus ID | 864 |
UniProt ID | Q13761 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the runt domain-containing family of transcription factors. A heterodimer of this protein and a beta subunit forms a complex that binds to the core DNA sequence 5'-PYGPYGGT-3' found in a number of enhancers and promoters, and can either activate or suppress transcription. It also interacts with other transcription factors. It functions as a tumor suppressor, and the gene is frequently deleted or transcriptionally silenced in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2), also known as p44, contains a distinct 5' UTR and uses an alternate translation initiation site, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220911 | RUNX3 (Myc-DDK-tagged)-Human runt-related transcription factor 3 (RUNX3), transcript variant 2 |
CNY 5,488.00 |
|
RC220911L3 | Lenti-ORF clone of RUNX3 (Myc-DDK-tagged)-Human runt-related transcription factor 3 (RUNX3), transcript variant 2 |
CNY 5,890.00 |
|
RC220911L4 | Lenti-ORF clone of RUNX3 (mGFP-tagged)-Human runt-related transcription factor 3 (RUNX3), transcript variant 2 |
CNY 5,890.00 |
|
RG220911 | RUNX3 (tGFP-tagged) - Human runt-related transcription factor 3 (RUNX3), transcript variant 2 |
CNY 4,370.00 |