EDDM3A (NM_006683) Human Untagged Clone
CAT#: SC303810
EDDM3A (untagged)-Human epididymal protein 3A (EDDM3A)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EP3A; FAM12A; HE3-ALPHA; HE3A; HE3ALPHA; RAM1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303810 representing NM_006683.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACATCCTCTCTAAAGATTTGGGGCATACTCTTGGCCCTGCTTTGCATCCTTTGCAGGCTGTGTGTA TACAGTAACAACATTTACTGGAGAGAATTCATAAAACTTCATTACTTAAGTCCAAGTCGAGAATTCAAA GAGTACAAATGTGATGTCCTCATGAGAGAAAAAGAGGCTCTGAAAGGCAAGAGCTTTCATATGTTCATC TATAGCTTATGGTTCAAAATTCAGCGTGCATGCATCAATGAGAAGGGGAGCGACCGATATAGAAATGCA TATGTATGGGCCCCAGGTGCCCTCAAAGTACTCGAGTGTCACTGGGAGAAGTACAACAATAGGTACACA GAGAGCAGAAGCTTCAGCTACATTGAATTCCATTGTGGCGTAGATGGATATGTTGATAACATAGAAGAC CTGAGGATTATAGAACCTATCAGCAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006683 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006683.4 |
RefSeq Size | 879 bp |
RefSeq ORF | 444 bp |
Locus ID | 10876 |
UniProt ID | Q14507 |
Protein Families | Secreted Protein, Transmembrane |
MW | 17.6 kDa |
Gene Summary | Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210112 | EDDM3A (Myc-DDK-tagged)-Human epididymal protein 3A (EDDM3A) |
CNY 1,200.00 |
|
RC210112L3 | Lenti ORF clone of Human epididymal protein 3A (EDDM3A), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210112L4 | Lenti ORF clone of Human epididymal protein 3A (EDDM3A), mGFP tagged |
CNY 5,890.00 |
|
RG210112 | EDDM3A (tGFP-tagged) - Human epididymal protein 3A (EDDM3A) |
CNY 2,800.00 |