CCR9 (NM_006641) Human Untagged Clone
CAT#: SC310507
CCR9 (untagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B
CNY 7,220.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CC-CKR-9; CDw199; GPR-9-6; GPR28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310507 representing NM_006641.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGATGACTATGGCTCTGAATCCACATCTTCCATGGAAGACTACGTTAACTTCAACTTCACTGAC TTCTACTGTGAGAAAAACAATGTCAGGCAGTTTGCGAGCCATTTCCTCCCACCCTTGTACTGGCTCGTG TTCATCGTGGGTGCCTTGGGCAACAGTCTTGTTATCCTTGTCTACTGGTACTGCACAAGAGTGAAGACC ATGACCGACATGTTCCTTTTGAATTTGGCAATTGCTGACCTCCTCTTTCTTGTCACTCTTCCCTTCTGG GCCATTGCTGCTGCTGACCAGTGGAAGTTCCAGACCTTCATGTGCAAGGTGGTCAACAGCATGTACAAG ATGAACTTCTACAGCTGTGTGTTGCTGATCATGTGCATCAGCGTGGACAGGTACATTGCCATTGCCCAG GCCATGAGAGCACATACTTGGAGGGAGAAAAGGCTTTTGTACAGCAAAATGGTTTGCTTTACCATCTGG GTATTGGCAGCTGCTCTCTGCATCCCAGAAATCTTATACAGCCAAATCAAGGAGGAATCCGGCATTGCT ATCTGCACCATGGTTTACCCTAGCGATGAGAGCACCAAACTGAAGTCAGCTGTCTTGACCCTGAAGGTC ATTCTGGGGTTCTTCCTTCCCTTCGTGGTCATGGCTTGCTGCTATACCATCATCATTCACACCCTGATA CAAGCCAAGAAGTCTTCCAAGCACAAAGCCCTAAAAGTGACCATCACTGTCCTGACCGTCTTTGTCTTG TCTCAGTTTCCCTACAACTGCATTTTGTTGGTGCAGACCATTGACGCCTATGCCATGTTCATCTCCAAC TGTGCCGTTTCCACCAACATTGACATCTGCTTCCAGGTCACCCAGACCATCGCCTTCTTCCACAGTTGC CTGAACCCTGTTCTCTATGTTTTTGTGGGTGAGAGATTCCGCCGGGATCTCGTGAAAACCCTGAAGAAC TTGGGTTGCATCAGCCAGGCCCAGTGGGTTTCATTTACAAGGAGAGAGGGAAGCTTGAAGCTGTCGTCT ATGTTGCTGGAGACAACCTCAGGAGCACTCTCCCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006641 |
Insert Size | 1074 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006641.3 |
RefSeq Size | 2518 bp |
RefSeq ORF | 1074 bp |
Locus ID | 10803 |
UniProt ID | P51686 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
MW | 40.7 kDa |
Gene Summary | The protein encoded by this gene is a G protein-coupled receptor with seven transmembrane domains that belongs to the beta chemokine receptor family. Chemokines and their receptors are key regulators of thymocyte migration and maturation in normal and inflammation conditions. This gene is differentially expressed in T lymphocytes of the small intestine and colon, and its interaction with chemokine 25 contributes to intestinal intra-epithelial lymphocyte homing to the small intestine. This suggests a role for this gene in directing immune responses to different segments of the gastrointestinal tract. This gene and its exclusive ligand, chemokine 25, are overexpressed in a variety of malignant tumors and are closely associated with tumor proliferation, apoptosis, invasion, migration and drug resistance. This gene maps to the chemokine receptor gene cluster. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (B) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants B and C encode the same isoform (B), which has a shorter N-terminus compared to isoform A. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Molecular Interaction of a Potent Nonpeptide Agonist with the Chemokine Receptor CCR8
,PC Jensen, R Nygaard, S Thiele, A Elder, G Zhu, R Kolbeck, S Ghosh, TW Schwartz, and MM Rosenkilde,
Mol Pharmacol. 2007 Aug;72(2):327-40.
[CCR9]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210246 | CCR9 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B |
CNY 3,656.00 |
|
RC210246L1 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC210246L2 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged |
CNY 5,890.00 |
|
RC210246L3 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210246L4 | Lenti ORF clone of Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B, mGFP tagged |
CNY 5,890.00 |
|
RG210246 | CCR9 (tGFP-tagged) - Human chemokine (C-C motif) receptor 9 (CCR9), transcript variant B |
CNY 5,256.00 |