Dysbindin (DTNBP1) (NM_183040) Human Untagged Clone

CAT#: SC312871

DTNBP1 (untagged)-Human dystrobrevin binding protein 1 (DTNBP1), transcript variant 2



  "NM_183040" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-DTNBP1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BLOC1S8; DBND; HPS7; My031; SDY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312871 representing NM_183040.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGAGACCCTTCGCGAGCGGCTGCTGAGCGTGCAGCAGGATTTCACCTCCGGGCTGAAGACTTTA
AGTGACAAGTCAAGAGAAGCAAAAGTGAAAAGCAAACCCAGGACTGTTCCATTTTTGCCAAAGTACTCT
GCTGGATTAGAATTACTTAGCAGGTATGAGGATACATGGGCTGCACTTCACAGAAGAGCCAAAGACTGT
GCAAGTGCTGGAGAGCTGGTGGATAGCGAGGTGGTCATGCTTTCTGCGCACTGGGAGAAGAAAAAGACA
AGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTCCCAGCTTTAATCGCAGACTTAGAATCCATGACA
GCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAGGTAGAGAACAACCTGCTGCATCTGGAAGACTTA
TGTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAGTCCCAGCAACTGGAGAATTACAAGAAAAAT
AAGAGGAAGGAACTTGAAACCTTCAAAGCTGAACTAGATGCAGAGCACGCCCAGAAGGTCCTGGAAATG
GAGCACACCCAGCAAATGAAGCTGAAGGAGCGGCAGAAGTTTTTTGAGGAAGCCTTCCAGCAGGACATG
GAGCAGTACCTGTCCACTGGCTACCTGCAGATTGCAGAGCGGCGAGAGCCCATAGGCAGCATGTCATCC
ATGGAAGTGAACGTGGACATGCTGGAGCAGATGGACCTGATGGACATATCGGACCAGGAGGCCCTGGAC
GTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTGCTGTCCCCCGCCTTAGGTAGGGTTGACAAACTT
GCATTAGCTGAACCAGGGCAGTATCGATGCCACTCCCCTCCAAAGGTGAGACGTGAGAACCATCTGCCA
GTCACTTACGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_183040
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_183040.2
RefSeq Size 1963 bp
RefSeq ORF 912 bp
Locus ID 84062
UniProt ID Q96EV8
Protein Families Druggable Genome
MW 34.8 kDa
Gene Summary This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a. This protein isoform is described by Talbot et al. (PMID:21390302).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...